ID: 1192528221

View in Genome Browser
Species Human (GRCh38)
Location X:71866376-71866398
Sequence CAGAGCAAGGAGCAGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192528221_1192528227 17 Left 1192528221 X:71866376-71866398 CCAGCCTTCTGCTCCTTGCTCTG No data
Right 1192528227 X:71866416-71866438 CTTCAACATTGCACAACCACAGG No data
1192528221_1192528225 -7 Left 1192528221 X:71866376-71866398 CCAGCCTTCTGCTCCTTGCTCTG No data
Right 1192528225 X:71866392-71866414 TGCTCTGCATGGTAGTGACCTGG No data
1192528221_1192528228 18 Left 1192528221 X:71866376-71866398 CCAGCCTTCTGCTCCTTGCTCTG No data
Right 1192528228 X:71866417-71866439 TTCAACATTGCACAACCACAGGG No data
1192528221_1192528229 19 Left 1192528221 X:71866376-71866398 CCAGCCTTCTGCTCCTTGCTCTG No data
Right 1192528229 X:71866418-71866440 TCAACATTGCACAACCACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192528221 Original CRISPR CAGAGCAAGGAGCAGAAGGC TGG (reversed) Intergenic
No off target data available for this crispr