ID: 1192528375

View in Genome Browser
Species Human (GRCh38)
Location X:71867233-71867255
Sequence GTATACCCTAGGCCATGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192528375_1192528379 6 Left 1192528375 X:71867233-71867255 CCCGACCATGGCCTAGGGTATAC No data
Right 1192528379 X:71867262-71867284 CAGCCCCATTATTGTGCAGAAGG No data
1192528375_1192528385 28 Left 1192528375 X:71867233-71867255 CCCGACCATGGCCTAGGGTATAC No data
Right 1192528385 X:71867284-71867306 GTGGTCTGAATATGGAACCGAGG No data
1192528375_1192528384 20 Left 1192528375 X:71867233-71867255 CCCGACCATGGCCTAGGGTATAC No data
Right 1192528384 X:71867276-71867298 TGCAGAAGGTGGTCTGAATATGG No data
1192528375_1192528381 9 Left 1192528375 X:71867233-71867255 CCCGACCATGGCCTAGGGTATAC No data
Right 1192528381 X:71867265-71867287 CCCCATTATTGTGCAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192528375 Original CRISPR GTATACCCTAGGCCATGGTC GGG (reversed) Intergenic
No off target data available for this crispr