ID: 1192528384

View in Genome Browser
Species Human (GRCh38)
Location X:71867276-71867298
Sequence TGCAGAAGGTGGTCTGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192528377_1192528384 15 Left 1192528377 X:71867238-71867260 CCATGGCCTAGGGTATACATGTT No data
Right 1192528384 X:71867276-71867298 TGCAGAAGGTGGTCTGAATATGG No data
1192528376_1192528384 19 Left 1192528376 X:71867234-71867256 CCGACCATGGCCTAGGGTATACA No data
Right 1192528384 X:71867276-71867298 TGCAGAAGGTGGTCTGAATATGG No data
1192528375_1192528384 20 Left 1192528375 X:71867233-71867255 CCCGACCATGGCCTAGGGTATAC No data
Right 1192528384 X:71867276-71867298 TGCAGAAGGTGGTCTGAATATGG No data
1192528378_1192528384 9 Left 1192528378 X:71867244-71867266 CCTAGGGTATACATGTTACAGCC No data
Right 1192528384 X:71867276-71867298 TGCAGAAGGTGGTCTGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192528384 Original CRISPR TGCAGAAGGTGGTCTGAATA TGG Intergenic
No off target data available for this crispr