ID: 1192528385

View in Genome Browser
Species Human (GRCh38)
Location X:71867284-71867306
Sequence GTGGTCTGAATATGGAACCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192528375_1192528385 28 Left 1192528375 X:71867233-71867255 CCCGACCATGGCCTAGGGTATAC No data
Right 1192528385 X:71867284-71867306 GTGGTCTGAATATGGAACCGAGG No data
1192528382_1192528385 -5 Left 1192528382 X:71867266-71867288 CCCATTATTGTGCAGAAGGTGGT No data
Right 1192528385 X:71867284-71867306 GTGGTCTGAATATGGAACCGAGG No data
1192528380_1192528385 -4 Left 1192528380 X:71867265-71867287 CCCCATTATTGTGCAGAAGGTGG No data
Right 1192528385 X:71867284-71867306 GTGGTCTGAATATGGAACCGAGG No data
1192528378_1192528385 17 Left 1192528378 X:71867244-71867266 CCTAGGGTATACATGTTACAGCC No data
Right 1192528385 X:71867284-71867306 GTGGTCTGAATATGGAACCGAGG No data
1192528377_1192528385 23 Left 1192528377 X:71867238-71867260 CCATGGCCTAGGGTATACATGTT No data
Right 1192528385 X:71867284-71867306 GTGGTCTGAATATGGAACCGAGG No data
1192528383_1192528385 -6 Left 1192528383 X:71867267-71867289 CCATTATTGTGCAGAAGGTGGTC No data
Right 1192528385 X:71867284-71867306 GTGGTCTGAATATGGAACCGAGG No data
1192528376_1192528385 27 Left 1192528376 X:71867234-71867256 CCGACCATGGCCTAGGGTATACA No data
Right 1192528385 X:71867284-71867306 GTGGTCTGAATATGGAACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192528385 Original CRISPR GTGGTCTGAATATGGAACCG AGG Intergenic
No off target data available for this crispr