ID: 1192531689

View in Genome Browser
Species Human (GRCh38)
Location X:71893168-71893190
Sequence AGTTATCTGCAGAGGATGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192531685_1192531689 16 Left 1192531685 X:71893129-71893151 CCGTGTAGCAAGTCAAAAACCAT No data
Right 1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG No data
1192531684_1192531689 25 Left 1192531684 X:71893120-71893142 CCACTGAAGCCGTGTAGCAAGTC No data
Right 1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG No data
1192531686_1192531689 -3 Left 1192531686 X:71893148-71893170 CCATTTCTCAAAATGAGTGTAGT No data
Right 1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192531689 Original CRISPR AGTTATCTGCAGAGGATGGT AGG Intergenic
No off target data available for this crispr