ID: 1192536502

View in Genome Browser
Species Human (GRCh38)
Location X:71932969-71932991
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192536502_1192536509 10 Left 1192536502 X:71932969-71932991 CCCTAGAAAGGCCCATCCCAAAT No data
Right 1192536509 X:71933002-71933024 AATAAGTGAAGATCACTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192536502 Original CRISPR ATTTGGGATGGGCCTTTCTA GGG (reversed) Intergenic
No off target data available for this crispr