ID: 1192536509

View in Genome Browser
Species Human (GRCh38)
Location X:71933002-71933024
Sequence AATAAGTGAAGATCACTACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192536504_1192536509 -1 Left 1192536504 X:71932980-71933002 CCCATCCCAAATAGTTTCCAATA No data
Right 1192536509 X:71933002-71933024 AATAAGTGAAGATCACTACTAGG No data
1192536506_1192536509 -6 Left 1192536506 X:71932985-71933007 CCCAAATAGTTTCCAATAATAAG No data
Right 1192536509 X:71933002-71933024 AATAAGTGAAGATCACTACTAGG No data
1192536500_1192536509 22 Left 1192536500 X:71932957-71932979 CCAGAGCTGACTCCCTAGAAAGG No data
Right 1192536509 X:71933002-71933024 AATAAGTGAAGATCACTACTAGG No data
1192536499_1192536509 30 Left 1192536499 X:71932949-71932971 CCATGACACCAGAGCTGACTCCC No data
Right 1192536509 X:71933002-71933024 AATAAGTGAAGATCACTACTAGG No data
1192536507_1192536509 -7 Left 1192536507 X:71932986-71933008 CCAAATAGTTTCCAATAATAAGT No data
Right 1192536509 X:71933002-71933024 AATAAGTGAAGATCACTACTAGG No data
1192536505_1192536509 -2 Left 1192536505 X:71932981-71933003 CCATCCCAAATAGTTTCCAATAA No data
Right 1192536509 X:71933002-71933024 AATAAGTGAAGATCACTACTAGG No data
1192536502_1192536509 10 Left 1192536502 X:71932969-71932991 CCCTAGAAAGGCCCATCCCAAAT No data
Right 1192536509 X:71933002-71933024 AATAAGTGAAGATCACTACTAGG No data
1192536503_1192536509 9 Left 1192536503 X:71932970-71932992 CCTAGAAAGGCCCATCCCAAATA No data
Right 1192536509 X:71933002-71933024 AATAAGTGAAGATCACTACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192536509 Original CRISPR AATAAGTGAAGATCACTACT AGG Intergenic
No off target data available for this crispr