ID: 1192537930

View in Genome Browser
Species Human (GRCh38)
Location X:71944410-71944432
Sequence TCTAAGATTTGGTAGGTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192537926_1192537930 -6 Left 1192537926 X:71944393-71944415 CCGGTCCTGAGTCAGGTTCTAAG No data
Right 1192537930 X:71944410-71944432 TCTAAGATTTGGTAGGTCTAAGG No data
1192537925_1192537930 0 Left 1192537925 X:71944387-71944409 CCTGCTCCGGTCCTGAGTCAGGT No data
Right 1192537930 X:71944410-71944432 TCTAAGATTTGGTAGGTCTAAGG No data
1192537922_1192537930 20 Left 1192537922 X:71944367-71944389 CCAGTTTAGAGAGTAAGTGGCCT No data
Right 1192537930 X:71944410-71944432 TCTAAGATTTGGTAGGTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192537930 Original CRISPR TCTAAGATTTGGTAGGTCTA AGG Intergenic
No off target data available for this crispr