ID: 1192539800

View in Genome Browser
Species Human (GRCh38)
Location X:71958237-71958259
Sequence ATCAAGGCATGGTGGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192539800_1192539813 16 Left 1192539800 X:71958237-71958259 CCTCCATCCCACCATGCCTTGAT No data
Right 1192539813 X:71958276-71958298 GTGGCCAAATGGACTTAGCTGGG No data
1192539800_1192539812 15 Left 1192539800 X:71958237-71958259 CCTCCATCCCACCATGCCTTGAT No data
Right 1192539812 X:71958275-71958297 AGTGGCCAAATGGACTTAGCTGG No data
1192539800_1192539815 27 Left 1192539800 X:71958237-71958259 CCTCCATCCCACCATGCCTTGAT No data
Right 1192539815 X:71958287-71958309 GACTTAGCTGGGCTGCTTGCTGG No data
1192539800_1192539807 5 Left 1192539800 X:71958237-71958259 CCTCCATCCCACCATGCCTTGAT No data
Right 1192539807 X:71958265-71958287 ACCCCCTACAAGTGGCCAAATGG No data
1192539800_1192539806 -3 Left 1192539800 X:71958237-71958259 CCTCCATCCCACCATGCCTTGAT No data
Right 1192539806 X:71958257-71958279 GATTTGAGACCCCCTACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192539800 Original CRISPR ATCAAGGCATGGTGGGATGG AGG (reversed) Intergenic
No off target data available for this crispr