ID: 1192539805

View in Genome Browser
Species Human (GRCh38)
Location X:71958253-71958275
Sequence TTGTAGGGGGTCTCAAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192539805_1192539816 18 Left 1192539805 X:71958253-71958275 CCTTGATTTGAGACCCCCTACAA No data
Right 1192539816 X:71958294-71958316 CTGGGCTGCTTGCTGGCTCATGG No data
1192539805_1192539813 0 Left 1192539805 X:71958253-71958275 CCTTGATTTGAGACCCCCTACAA No data
Right 1192539813 X:71958276-71958298 GTGGCCAAATGGACTTAGCTGGG No data
1192539805_1192539812 -1 Left 1192539805 X:71958253-71958275 CCTTGATTTGAGACCCCCTACAA No data
Right 1192539812 X:71958275-71958297 AGTGGCCAAATGGACTTAGCTGG No data
1192539805_1192539817 19 Left 1192539805 X:71958253-71958275 CCTTGATTTGAGACCCCCTACAA No data
Right 1192539817 X:71958295-71958317 TGGGCTGCTTGCTGGCTCATGGG No data
1192539805_1192539815 11 Left 1192539805 X:71958253-71958275 CCTTGATTTGAGACCCCCTACAA No data
Right 1192539815 X:71958287-71958309 GACTTAGCTGGGCTGCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192539805 Original CRISPR TTGTAGGGGGTCTCAAATCA AGG (reversed) Intergenic
No off target data available for this crispr