ID: 1192539807

View in Genome Browser
Species Human (GRCh38)
Location X:71958265-71958287
Sequence ACCCCCTACAAGTGGCCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192539800_1192539807 5 Left 1192539800 X:71958237-71958259 CCTCCATCCCACCATGCCTTGAT No data
Right 1192539807 X:71958265-71958287 ACCCCCTACAAGTGGCCAAATGG No data
1192539802_1192539807 -2 Left 1192539802 X:71958244-71958266 CCCACCATGCCTTGATTTGAGAC No data
Right 1192539807 X:71958265-71958287 ACCCCCTACAAGTGGCCAAATGG No data
1192539803_1192539807 -3 Left 1192539803 X:71958245-71958267 CCACCATGCCTTGATTTGAGACC No data
Right 1192539807 X:71958265-71958287 ACCCCCTACAAGTGGCCAAATGG No data
1192539801_1192539807 2 Left 1192539801 X:71958240-71958262 CCATCCCACCATGCCTTGATTTG No data
Right 1192539807 X:71958265-71958287 ACCCCCTACAAGTGGCCAAATGG No data
1192539799_1192539807 30 Left 1192539799 X:71958212-71958234 CCTCACTATAACTGCGTGTTTTC No data
Right 1192539807 X:71958265-71958287 ACCCCCTACAAGTGGCCAAATGG No data
1192539804_1192539807 -6 Left 1192539804 X:71958248-71958270 CCATGCCTTGATTTGAGACCCCC No data
Right 1192539807 X:71958265-71958287 ACCCCCTACAAGTGGCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192539807 Original CRISPR ACCCCCTACAAGTGGCCAAA TGG Intergenic
No off target data available for this crispr