ID: 1192539815

View in Genome Browser
Species Human (GRCh38)
Location X:71958287-71958309
Sequence GACTTAGCTGGGCTGCTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192539804_1192539815 16 Left 1192539804 X:71958248-71958270 CCATGCCTTGATTTGAGACCCCC No data
Right 1192539815 X:71958287-71958309 GACTTAGCTGGGCTGCTTGCTGG No data
1192539809_1192539815 -3 Left 1192539809 X:71958267-71958289 CCCCTACAAGTGGCCAAATGGAC No data
Right 1192539815 X:71958287-71958309 GACTTAGCTGGGCTGCTTGCTGG No data
1192539811_1192539815 -5 Left 1192539811 X:71958269-71958291 CCTACAAGTGGCCAAATGGACTT No data
Right 1192539815 X:71958287-71958309 GACTTAGCTGGGCTGCTTGCTGG No data
1192539810_1192539815 -4 Left 1192539810 X:71958268-71958290 CCCTACAAGTGGCCAAATGGACT No data
Right 1192539815 X:71958287-71958309 GACTTAGCTGGGCTGCTTGCTGG No data
1192539803_1192539815 19 Left 1192539803 X:71958245-71958267 CCACCATGCCTTGATTTGAGACC No data
Right 1192539815 X:71958287-71958309 GACTTAGCTGGGCTGCTTGCTGG No data
1192539801_1192539815 24 Left 1192539801 X:71958240-71958262 CCATCCCACCATGCCTTGATTTG No data
Right 1192539815 X:71958287-71958309 GACTTAGCTGGGCTGCTTGCTGG No data
1192539800_1192539815 27 Left 1192539800 X:71958237-71958259 CCTCCATCCCACCATGCCTTGAT No data
Right 1192539815 X:71958287-71958309 GACTTAGCTGGGCTGCTTGCTGG No data
1192539808_1192539815 -2 Left 1192539808 X:71958266-71958288 CCCCCTACAAGTGGCCAAATGGA No data
Right 1192539815 X:71958287-71958309 GACTTAGCTGGGCTGCTTGCTGG No data
1192539805_1192539815 11 Left 1192539805 X:71958253-71958275 CCTTGATTTGAGACCCCCTACAA No data
Right 1192539815 X:71958287-71958309 GACTTAGCTGGGCTGCTTGCTGG No data
1192539802_1192539815 20 Left 1192539802 X:71958244-71958266 CCCACCATGCCTTGATTTGAGAC No data
Right 1192539815 X:71958287-71958309 GACTTAGCTGGGCTGCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192539815 Original CRISPR GACTTAGCTGGGCTGCTTGC TGG Intergenic
No off target data available for this crispr