ID: 1192539817

View in Genome Browser
Species Human (GRCh38)
Location X:71958295-71958317
Sequence TGGGCTGCTTGCTGGCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192539803_1192539817 27 Left 1192539803 X:71958245-71958267 CCACCATGCCTTGATTTGAGACC No data
Right 1192539817 X:71958295-71958317 TGGGCTGCTTGCTGGCTCATGGG No data
1192539808_1192539817 6 Left 1192539808 X:71958266-71958288 CCCCCTACAAGTGGCCAAATGGA No data
Right 1192539817 X:71958295-71958317 TGGGCTGCTTGCTGGCTCATGGG No data
1192539804_1192539817 24 Left 1192539804 X:71958248-71958270 CCATGCCTTGATTTGAGACCCCC No data
Right 1192539817 X:71958295-71958317 TGGGCTGCTTGCTGGCTCATGGG No data
1192539802_1192539817 28 Left 1192539802 X:71958244-71958266 CCCACCATGCCTTGATTTGAGAC No data
Right 1192539817 X:71958295-71958317 TGGGCTGCTTGCTGGCTCATGGG No data
1192539814_1192539817 -8 Left 1192539814 X:71958280-71958302 CCAAATGGACTTAGCTGGGCTGC No data
Right 1192539817 X:71958295-71958317 TGGGCTGCTTGCTGGCTCATGGG No data
1192539810_1192539817 4 Left 1192539810 X:71958268-71958290 CCCTACAAGTGGCCAAATGGACT No data
Right 1192539817 X:71958295-71958317 TGGGCTGCTTGCTGGCTCATGGG No data
1192539809_1192539817 5 Left 1192539809 X:71958267-71958289 CCCCTACAAGTGGCCAAATGGAC No data
Right 1192539817 X:71958295-71958317 TGGGCTGCTTGCTGGCTCATGGG No data
1192539811_1192539817 3 Left 1192539811 X:71958269-71958291 CCTACAAGTGGCCAAATGGACTT No data
Right 1192539817 X:71958295-71958317 TGGGCTGCTTGCTGGCTCATGGG No data
1192539805_1192539817 19 Left 1192539805 X:71958253-71958275 CCTTGATTTGAGACCCCCTACAA No data
Right 1192539817 X:71958295-71958317 TGGGCTGCTTGCTGGCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192539817 Original CRISPR TGGGCTGCTTGCTGGCTCAT GGG Intergenic
No off target data available for this crispr