ID: 1192541246

View in Genome Browser
Species Human (GRCh38)
Location X:71975086-71975108
Sequence TATGCTGGCCGCAGGACTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192541242_1192541246 -4 Left 1192541242 X:71975067-71975089 CCTAAAGCTGGCAACCTCATATG No data
Right 1192541246 X:71975086-71975108 TATGCTGGCCGCAGGACTACTGG No data
1192541241_1192541246 4 Left 1192541241 X:71975059-71975081 CCTTAGTGCCTAAAGCTGGCAAC No data
Right 1192541246 X:71975086-71975108 TATGCTGGCCGCAGGACTACTGG No data
1192541239_1192541246 12 Left 1192541239 X:71975051-71975073 CCACTGCTCCTTAGTGCCTAAAG No data
Right 1192541246 X:71975086-71975108 TATGCTGGCCGCAGGACTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192541246 Original CRISPR TATGCTGGCCGCAGGACTAC TGG Intergenic
No off target data available for this crispr