ID: 1192544636

View in Genome Browser
Species Human (GRCh38)
Location X:72003461-72003483
Sequence CAAAATGCTCAGGTTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192544625_1192544636 27 Left 1192544625 X:72003411-72003433 CCACTAGGTTACTCCAGGTTTCA No data
Right 1192544636 X:72003461-72003483 CAAAATGCTCAGGTTCAGCTGGG No data
1192544626_1192544636 14 Left 1192544626 X:72003424-72003446 CCAGGTTTCATGTGTCCACAGCC No data
Right 1192544636 X:72003461-72003483 CAAAATGCTCAGGTTCAGCTGGG No data
1192544630_1192544636 -7 Left 1192544630 X:72003445-72003467 CCCTGCTTAGGGCCACCAAAATG No data
Right 1192544636 X:72003461-72003483 CAAAATGCTCAGGTTCAGCTGGG No data
1192544629_1192544636 -1 Left 1192544629 X:72003439-72003461 CCACAGCCCTGCTTAGGGCCACC No data
Right 1192544636 X:72003461-72003483 CAAAATGCTCAGGTTCAGCTGGG No data
1192544631_1192544636 -8 Left 1192544631 X:72003446-72003468 CCTGCTTAGGGCCACCAAAATGC No data
Right 1192544636 X:72003461-72003483 CAAAATGCTCAGGTTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192544636 Original CRISPR CAAAATGCTCAGGTTCAGCT GGG Intergenic
No off target data available for this crispr