ID: 1192546460

View in Genome Browser
Species Human (GRCh38)
Location X:72018598-72018620
Sequence CGGAGGCGGCGAGCCTGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 80}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192546449_1192546460 28 Left 1192546449 X:72018547-72018569 CCCGGGCTGCTTTTCGTGCGCGG No data
Right 1192546460 X:72018598-72018620 CGGAGGCGGCGAGCCTGCGAGGG 0: 1
1: 0
2: 0
3: 16
4: 80
1192546451_1192546460 27 Left 1192546451 X:72018548-72018570 CCGGGCTGCTTTTCGTGCGCGGA No data
Right 1192546460 X:72018598-72018620 CGGAGGCGGCGAGCCTGCGAGGG 0: 1
1: 0
2: 0
3: 16
4: 80
1192546455_1192546460 -5 Left 1192546455 X:72018580-72018602 CCAGTCACCAGGCGCGTGCGGAG No data
Right 1192546460 X:72018598-72018620 CGGAGGCGGCGAGCCTGCGAGGG 0: 1
1: 0
2: 0
3: 16
4: 80
1192546447_1192546460 30 Left 1192546447 X:72018545-72018567 CCCCCGGGCTGCTTTTCGTGCGC No data
Right 1192546460 X:72018598-72018620 CGGAGGCGGCGAGCCTGCGAGGG 0: 1
1: 0
2: 0
3: 16
4: 80
1192546448_1192546460 29 Left 1192546448 X:72018546-72018568 CCCCGGGCTGCTTTTCGTGCGCG No data
Right 1192546460 X:72018598-72018620 CGGAGGCGGCGAGCCTGCGAGGG 0: 1
1: 0
2: 0
3: 16
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192546460 Original CRISPR CGGAGGCGGCGAGCCTGCGA GGG Intergenic