ID: 1192546670

View in Genome Browser
Species Human (GRCh38)
Location X:72019961-72019983
Sequence CAGAGGAAGCAGATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192546670_1192546676 19 Left 1192546670 X:72019961-72019983 CCCTTCTCCATCTGCTTCCTCTG No data
Right 1192546676 X:72020003-72020025 CCCCTGAATCCTATCCCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192546670 Original CRISPR CAGAGGAAGCAGATGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr