ID: 1192547013

View in Genome Browser
Species Human (GRCh38)
Location X:72022631-72022653
Sequence TACGGGGAGATGGGGCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192547013_1192547020 -9 Left 1192547013 X:72022631-72022653 CCCAAAGGCCCCATCTCCCCGTA No data
Right 1192547020 X:72022645-72022667 CTCCCCGTACCATCTCACTGGGG No data
1192547013_1192547019 -10 Left 1192547013 X:72022631-72022653 CCCAAAGGCCCCATCTCCCCGTA No data
Right 1192547019 X:72022644-72022666 TCTCCCCGTACCATCTCACTGGG No data
1192547013_1192547027 17 Left 1192547013 X:72022631-72022653 CCCAAAGGCCCCATCTCCCCGTA No data
Right 1192547027 X:72022671-72022693 AGGGTTTCAACATATGAAGAAGG No data
1192547013_1192547028 18 Left 1192547013 X:72022631-72022653 CCCAAAGGCCCCATCTCCCCGTA No data
Right 1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG No data
1192547013_1192547024 -3 Left 1192547013 X:72022631-72022653 CCCAAAGGCCCCATCTCCCCGTA No data
Right 1192547024 X:72022651-72022673 GTACCATCTCACTGGGGAGTAGG No data
1192547013_1192547025 -2 Left 1192547013 X:72022631-72022653 CCCAAAGGCCCCATCTCCCCGTA No data
Right 1192547025 X:72022652-72022674 TACCATCTCACTGGGGAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192547013 Original CRISPR TACGGGGAGATGGGGCCTTT GGG (reversed) Intergenic
No off target data available for this crispr