ID: 1192547016

View in Genome Browser
Species Human (GRCh38)
Location X:72022640-72022662
Sequence GTGAGATGGTACGGGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192547016_1192547028 9 Left 1192547016 X:72022640-72022662 CCCATCTCCCCGTACCATCTCAC No data
Right 1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG No data
1192547016_1192547027 8 Left 1192547016 X:72022640-72022662 CCCATCTCCCCGTACCATCTCAC No data
Right 1192547027 X:72022671-72022693 AGGGTTTCAACATATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192547016 Original CRISPR GTGAGATGGTACGGGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr