ID: 1192547023 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:72022649-72022671 |
| Sequence | TACTCCCCAGTGAGATGGTA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1192547023_1192547027 | -1 | Left | 1192547023 | X:72022649-72022671 | CCGTACCATCTCACTGGGGAGTA | No data | ||
| Right | 1192547027 | X:72022671-72022693 | AGGGTTTCAACATATGAAGAAGG | No data | ||||
| 1192547023_1192547028 | 0 | Left | 1192547023 | X:72022649-72022671 | CCGTACCATCTCACTGGGGAGTA | No data | ||
| Right | 1192547028 | X:72022672-72022694 | GGGTTTCAACATATGAAGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1192547023 | Original CRISPR | TACTCCCCAGTGAGATGGTA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||