ID: 1192547028

View in Genome Browser
Species Human (GRCh38)
Location X:72022672-72022694
Sequence GGGTTTCAACATATGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192547026_1192547028 -5 Left 1192547026 X:72022654-72022676 CCATCTCACTGGGGAGTAGGGTT No data
Right 1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG No data
1192547023_1192547028 0 Left 1192547023 X:72022649-72022671 CCGTACCATCTCACTGGGGAGTA No data
Right 1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG No data
1192547022_1192547028 1 Left 1192547022 X:72022648-72022670 CCCGTACCATCTCACTGGGGAGT No data
Right 1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG No data
1192547014_1192547028 17 Left 1192547014 X:72022632-72022654 CCAAAGGCCCCATCTCCCCGTAC No data
Right 1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG No data
1192547015_1192547028 10 Left 1192547015 X:72022639-72022661 CCCCATCTCCCCGTACCATCTCA No data
Right 1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG No data
1192547021_1192547028 2 Left 1192547021 X:72022647-72022669 CCCCGTACCATCTCACTGGGGAG No data
Right 1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG No data
1192547016_1192547028 9 Left 1192547016 X:72022640-72022662 CCCATCTCCCCGTACCATCTCAC No data
Right 1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG No data
1192547012_1192547028 21 Left 1192547012 X:72022628-72022650 CCTCCCAAAGGCCCCATCTCCCC No data
Right 1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG No data
1192547017_1192547028 8 Left 1192547017 X:72022641-72022663 CCATCTCCCCGTACCATCTCACT No data
Right 1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG No data
1192547013_1192547028 18 Left 1192547013 X:72022631-72022653 CCCAAAGGCCCCATCTCCCCGTA No data
Right 1192547028 X:72022672-72022694 GGGTTTCAACATATGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192547028 Original CRISPR GGGTTTCAACATATGAAGAA GGG Intergenic
No off target data available for this crispr