ID: 1192547794

View in Genome Browser
Species Human (GRCh38)
Location X:72027994-72028016
Sequence AGTGGCAGCAGCAGCAGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192547794_1192547798 -1 Left 1192547794 X:72027994-72028016 CCGCTGCTGCTGCTGCTGCCACT No data
Right 1192547798 X:72028016-72028038 TGCTGCTGCTAGAGGAATGGAGG No data
1192547794_1192547797 -4 Left 1192547794 X:72027994-72028016 CCGCTGCTGCTGCTGCTGCCACT No data
Right 1192547797 X:72028013-72028035 CACTGCTGCTGCTAGAGGAATGG No data
1192547794_1192547800 7 Left 1192547794 X:72027994-72028016 CCGCTGCTGCTGCTGCTGCCACT No data
Right 1192547800 X:72028024-72028046 CTAGAGGAATGGAGGCCAGAGGG No data
1192547794_1192547801 14 Left 1192547794 X:72027994-72028016 CCGCTGCTGCTGCTGCTGCCACT No data
Right 1192547801 X:72028031-72028053 AATGGAGGCCAGAGGGTGCTAGG No data
1192547794_1192547795 -9 Left 1192547794 X:72027994-72028016 CCGCTGCTGCTGCTGCTGCCACT No data
Right 1192547795 X:72028008-72028030 GCTGCCACTGCTGCTGCTAGAGG No data
1192547794_1192547799 6 Left 1192547794 X:72027994-72028016 CCGCTGCTGCTGCTGCTGCCACT No data
Right 1192547799 X:72028023-72028045 GCTAGAGGAATGGAGGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192547794 Original CRISPR AGTGGCAGCAGCAGCAGCAG CGG (reversed) Intergenic
No off target data available for this crispr