ID: 1192547800

View in Genome Browser
Species Human (GRCh38)
Location X:72028024-72028046
Sequence CTAGAGGAATGGAGGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192547794_1192547800 7 Left 1192547794 X:72027994-72028016 CCGCTGCTGCTGCTGCTGCCACT No data
Right 1192547800 X:72028024-72028046 CTAGAGGAATGGAGGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192547800 Original CRISPR CTAGAGGAATGGAGGCCAGA GGG Intergenic
No off target data available for this crispr