ID: 1192548929

View in Genome Browser
Species Human (GRCh38)
Location X:72038053-72038075
Sequence CCACTCTCATACCTTGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192548929_1192548938 18 Left 1192548929 X:72038053-72038075 CCAGGTGCAAGGTATGAGAGTGG No data
Right 1192548938 X:72038094-72038116 CTAGTCACATTTCTTGTCTTTGG No data
1192548929_1192548936 -7 Left 1192548929 X:72038053-72038075 CCAGGTGCAAGGTATGAGAGTGG No data
Right 1192548936 X:72038069-72038091 AGAGTGGGGTCTGGGAGTCTGGG No data
1192548929_1192548935 -8 Left 1192548929 X:72038053-72038075 CCAGGTGCAAGGTATGAGAGTGG No data
Right 1192548935 X:72038068-72038090 GAGAGTGGGGTCTGGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192548929 Original CRISPR CCACTCTCATACCTTGCACC TGG (reversed) Intergenic
No off target data available for this crispr