ID: 1192554412

View in Genome Browser
Species Human (GRCh38)
Location X:72078538-72078560
Sequence CTGTGGTTAGAGAGGAAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192554412_1192554416 -6 Left 1192554412 X:72078538-72078560 CCCTCTTTCCTCTCTAACCACAG No data
Right 1192554416 X:72078555-72078577 CCACAGCCAGACTTCCTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192554412 Original CRISPR CTGTGGTTAGAGAGGAAAGA GGG (reversed) Intergenic
No off target data available for this crispr