ID: 1192556130

View in Genome Browser
Species Human (GRCh38)
Location X:72091114-72091136
Sequence CTGGAAAGAAGTGGAATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192556127_1192556130 29 Left 1192556127 X:72091062-72091084 CCAATGTTCATGTGTTCTTTGTT No data
Right 1192556130 X:72091114-72091136 CTGGAAAGAAGTGGAATTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192556130 Original CRISPR CTGGAAAGAAGTGGAATTGT TGG Intergenic
No off target data available for this crispr