ID: 1192558620

View in Genome Browser
Species Human (GRCh38)
Location X:72110047-72110069
Sequence CTCTGTTCCCGGCATCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192558620_1192558627 -2 Left 1192558620 X:72110047-72110069 CCCCAAGGATGCCGGGAACAGAG No data
Right 1192558627 X:72110068-72110090 AGGGGTGAAGTGCTTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192558620 Original CRISPR CTCTGTTCCCGGCATCCTTG GGG (reversed) Intergenic