ID: 1192561388

View in Genome Browser
Species Human (GRCh38)
Location X:72130288-72130310
Sequence AGGAACAAGAATGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1549
Summary {0: 1, 1: 0, 2: 19, 3: 169, 4: 1360}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192561388 Original CRISPR AGGAACAAGAATGAGGAGGA AGG (reversed) Exonic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900471948 1:2859431-2859453 AGGAGAAAGAAGGAGGGGGAAGG + Intergenic
900572122 1:3363795-3363817 AAGAAGGAGAAGGAGGAGGAAGG + Intronic
900725553 1:4214191-4214213 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
900816745 1:4853205-4853227 AGGATAAAGGAGGAGGAGGAAGG - Intergenic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
902206409 1:14871322-14871344 AGGAACAAGAGTCAAGAGGGAGG + Intronic
902489575 1:16771412-16771434 AAGAAGAAGAAGGAGGAAGAGGG + Intronic
902675724 1:18007331-18007353 AAGAAAGAGAATGAGAAGGAAGG + Intergenic
902756062 1:18550050-18550072 AGGAGCAAGAGAGGGGAGGAGGG - Intergenic
902778571 1:18690296-18690318 AGGAAGAGGAGTGGGGAGGAAGG + Intronic
902926417 1:19698703-19698725 AGGAAGAAGAAAGGGAAGGAGGG - Intronic
903414713 1:23174291-23174313 CAGAACAAAAAAGAGGAGGAAGG - Intronic
903742428 1:25565949-25565971 AGGAAGAGGAAGGAGGAGGCAGG - Intronic
903805791 1:26004897-26004919 GTGACCAAGAATGAGGAGGTGGG - Intergenic
903989196 1:27253428-27253450 AGGAGGAGGAAGGAGGAGGAGGG - Intronic
904111066 1:28126523-28126545 AGGCAGAATAATGTGGAGGAAGG - Intergenic
904404935 1:30281345-30281367 AGGAACAAGAATGAGGAACAAGG + Intergenic
904649272 1:31992247-31992269 AAAAAAAAGAATGAGTAGGAGGG - Intergenic
904923117 1:34024338-34024360 AGAAACAGTGATGAGGAGGAAGG - Intronic
904940156 1:34160084-34160106 AGGCACATGAATGAGGGTGAAGG + Intronic
905063580 1:35160548-35160570 AGGAAAAAGACAGAGGAGAAAGG - Intergenic
905081327 1:35323646-35323668 AGGCAGGAGAATGAGGAGAATGG - Intronic
905260235 1:36712130-36712152 AAGGAGAAGAAAGAGGAGGAAGG - Intergenic
905575798 1:39043701-39043723 AAGAAAAAGAAAGAAGAGGAAGG + Intergenic
906180836 1:43817507-43817529 AGGAAGAAGAATGAAGAAGAAGG - Intronic
906180877 1:43817733-43817755 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
906275242 1:44510379-44510401 AGGAACAGGTTTGGGGAGGAAGG - Intronic
906549813 1:46655058-46655080 AGGAAGAAGAATGAGCAAAAGGG + Intronic
906730586 1:48077610-48077632 GGGAAGGAGAATGAGAAGGAGGG + Intergenic
907995341 1:59625683-59625705 AGGCCCAAGAATGAGAAGGAAGG - Intronic
908376459 1:63547041-63547063 GGGAAAAAGAATGGGGAGGTGGG - Intronic
908657676 1:66405249-66405271 AGGAACAAGAAGGGGGAAGGAGG - Intergenic
909159525 1:72128890-72128912 TGGAACAAAAAAGAGAAGGAAGG + Intronic
909251224 1:73359223-73359245 AGCAAAAAGAATGTAGAGGAGGG + Intergenic
909253666 1:73390613-73390635 AGAAGAAAGAAGGAGGAGGAGGG - Intergenic
909349811 1:74638027-74638049 AGGAAGGAGGATGAGAAGGATGG + Intronic
909660006 1:78071534-78071556 AAGAAGAAGAAGGAGAAGGAAGG - Intronic
909686563 1:78355277-78355299 AGAAAAAAGAATGAGGAGAAGGG - Intronic
910033317 1:82759003-82759025 GGGAAGAAGAACGAGGAGAAGGG - Intergenic
910654132 1:89602964-89602986 AGTGAGAAGAGTGAGGAGGAGGG + Intergenic
910983082 1:92977932-92977954 AGGAGCAAGAATAGGGAGGATGG - Intergenic
911008757 1:93255783-93255805 AGGAAGAAGAAGGAGGGGGGAGG + Intronic
911058266 1:93726024-93726046 AAGAAGAAGAATAAGGAAGAGGG - Intronic
911201025 1:95043822-95043844 AGGAAGAAGAGAGAGAAGGAGGG + Intronic
911543737 1:99190312-99190334 AGGAAGAAGAATAAGATGGAAGG + Intergenic
911632813 1:100201351-100201373 AGAAAAAAGAATGAGAAGGAAGG + Intronic
911653165 1:100412491-100412513 AGGAAAATGAAGAAGGAGGAAGG - Intronic
912065523 1:105736389-105736411 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
912146358 1:106798876-106798898 AGCGACTAGAATGAGGATGAAGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912528042 1:110299446-110299468 AGGAACTAGGATGGGGAGGAGGG - Intergenic
912580494 1:110716897-110716919 AGAAAAAAGAATGAAGGGGAAGG + Intergenic
912703370 1:111894910-111894932 AGGAAGAGGAAAGAGGAGAAGGG + Intronic
912887453 1:113489837-113489859 AGGCAAAAGAATGAAAAGGAAGG + Intronic
913079915 1:115374063-115374085 AAGAATTAGAATGAGGAGGTGGG - Intergenic
913098713 1:115543447-115543469 AGGAGTAAGGATGAGGAGAAAGG + Intergenic
913136619 1:115896671-115896693 AGGAGTAAGAATGAGGAAGATGG - Intergenic
913332361 1:117678096-117678118 AGGAAGAAAGAGGAGGAGGAAGG + Intergenic
913963694 1:143357590-143357612 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
913996523 1:143655214-143655236 AGGAAGAGGAAGGAGGAGGAGGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914505732 1:148287597-148287619 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
914519645 1:148404094-148404116 AGAAAAAAGGAGGAGGAGGAAGG - Intergenic
914677062 1:149913611-149913633 GGGACCCAGGATGAGGAGGAAGG - Exonic
914848027 1:151293472-151293494 AGGGGCAGGAATGGGGAGGAGGG + Intronic
914926395 1:151892251-151892273 AGGAGCAAGTAGAAGGAGGAGGG + Intronic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915047182 1:153028005-153028027 AGGAAGGAGAAGGAGAAGGAGGG - Intergenic
915271324 1:154755817-154755839 AAGAAGAAGAAGGAGGAGGAGGG + Intronic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915912835 1:159924964-159924986 AGGAACAGGAATGAAAAGGGCGG + Intronic
916047703 1:161013143-161013165 AAAAAGAAGAAAGAGGAGGAGGG + Intronic
916091294 1:161309722-161309744 AAGAACAAGCAGGAGCAGGAAGG - Intronic
916149335 1:161771206-161771228 AGGAGAAAGGAGGAGGAGGAGGG - Intronic
916332131 1:163628509-163628531 AGGAAGAGGAAGGAGAAGGAGGG - Intergenic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916386040 1:164271679-164271701 AGGAAAAAGAGAGAGAAGGAAGG + Intergenic
916528630 1:165634833-165634855 ATGATCAAGAATGAGAAGGAAGG - Intronic
916651104 1:166835567-166835589 AAGCAGAAGAAGGAGGAGGAAGG - Intergenic
916664135 1:166950205-166950227 GGGAAAAAGAATGAGGGAGAAGG - Intronic
916875460 1:168963981-168964003 AGGAAAAGGAAGGAGGAGGAAGG - Intergenic
917023228 1:170613219-170613241 AGAAAAAAGAATGAAAAGGAAGG - Intergenic
917173428 1:172203145-172203167 AGGACAAAGAATGAGCTGGAGGG + Intronic
917247661 1:173022229-173022251 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
917313592 1:173702588-173702610 AGGAAGAAGGAGAAGGAGGAAGG + Intergenic
917966835 1:180184124-180184146 AGGAAGAAGAATGAGCAAGAGGG - Intronic
918179498 1:182074124-182074146 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
918337767 1:183537468-183537490 AATAGTAAGAATGAGGAGGAAGG - Intronic
918882404 1:190141856-190141878 AGGAAAAATAATGAGGATTAAGG - Intronic
918957464 1:191228147-191228169 AGGAAAGAGAATGAAGAAGATGG + Intergenic
919011429 1:191970180-191970202 AGGAACAAGTAAGAGTAGGAAGG - Intergenic
919074595 1:192798050-192798072 AGGAACAAGAGGGAGAGGGAGGG - Intergenic
919201668 1:194362820-194362842 AGCAATAAGAATGGAGAGGATGG + Intergenic
919566558 1:199195925-199195947 AGGAGCAAGAGAGAGGAGGGAGG - Intergenic
919759389 1:201087777-201087799 AGAAAAGAGAAAGAGGAGGAGGG - Intronic
919846123 1:201643291-201643313 AAGAAAAAGAAAGAGAAGGAAGG - Intronic
920014133 1:202892354-202892376 AGGAACAAGAACCAGGACGACGG + Exonic
920374878 1:205502894-205502916 GGGGACAAGAGAGAGGAGGAAGG - Intergenic
920663399 1:207939287-207939309 AGGAACAAGTAGGAGGTGGGTGG + Intergenic
921083530 1:211764910-211764932 AGGAACAAGGCTCAAGAGGAGGG - Intronic
921259887 1:213376904-213376926 GAGAAGAAGAATGAGGTGGAGGG + Intergenic
921490022 1:215763711-215763733 AGGAAAAAGAATCAGGATGTGGG + Intronic
921771797 1:219049125-219049147 AGAAAGAAGAATGAGGAGGCTGG + Intergenic
921866100 1:220089118-220089140 AAAAAAAAGAAGGAGGAGGAAGG + Intronic
922406505 1:225319604-225319626 AGAAACAAGCAAGAGAAGGAGGG + Intronic
922416347 1:225426863-225426885 AGGGAGAAGAACGAGCAGGAGGG - Intronic
922722740 1:227906839-227906861 AGGAAGGAGGATGAGGAAGAGGG - Intergenic
922865626 1:228859193-228859215 TGGAACAAGAAGGTGGAGGAAGG - Intergenic
922867874 1:228875943-228875965 AGGAATAATAAGGAGGAGGAGGG - Intergenic
922936290 1:229425707-229425729 AAGGAGAAGAAAGAGGAGGAGGG + Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
923530862 1:234811113-234811135 AAGAAGAAGAAGGAGGAAGAGGG - Intergenic
923538813 1:234873540-234873562 AGGAAGAAGAATTAGAATGAAGG - Intergenic
923666497 1:236002917-236002939 GGGAGGAATAATGAGGAGGAGGG - Intronic
923696127 1:236254274-236254296 GGGAACAAGAAAAGGGAGGAAGG - Intronic
923837069 1:237623731-237623753 AAAAACAAGAAAGAGGAAGAAGG - Intronic
924280674 1:242433942-242433964 AGGTCAGAGAATGAGGAGGAAGG + Intronic
924307611 1:242707507-242707529 AGGGAAAAGACGGAGGAGGATGG - Intergenic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924619006 1:245643857-245643879 AGGAACAAAGATAAGGATGACGG - Intronic
924864868 1:247967882-247967904 AGGACGAGGAAGGAGGAGGAAGG - Intronic
1062936557 10:1394899-1394921 AGGAAGAAGAAGGAGGAGGAGGG - Intronic
1063159492 10:3408895-3408917 AGGAGGAGGAAAGAGGAGGAGGG + Intergenic
1063159507 10:3408952-3408974 AGGAAGAAAGAGGAGGAGGAGGG + Intergenic
1063218532 10:3945075-3945097 AGGAGAAAGAATGAGGCTGATGG + Intergenic
1063413926 10:5857926-5857948 GGGAACAGGAATGAAGGGGAGGG - Intergenic
1063440793 10:6071420-6071442 AGGAAGAGGAAGGAGGAGGGAGG - Intergenic
1063497162 10:6520590-6520612 AGGAACTTGAAAGATGAGGAAGG - Intronic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1063850075 10:10177860-10177882 AGGAAGGAGAAGGAGAAGGAAGG - Intergenic
1063850078 10:10177876-10177898 AGGAGAAAGAAGGAGAAGGAAGG - Intergenic
1063850082 10:10177902-10177924 AGGAAGGAGAAGGAGAAGGAAGG - Intergenic
1064017081 10:11781109-11781131 AGGAACAAAAAGGCAGAGGAAGG - Intergenic
1064121746 10:12624983-12625005 AGGAGGAGGAAAGAGGAGGAAGG - Intronic
1064276289 10:13908289-13908311 AGGAAAAAGGATGAGAAGCATGG - Intronic
1064341510 10:14489884-14489906 AGGAAAAGGAAAGAGAAGGAGGG + Intergenic
1064352465 10:14588813-14588835 AGGAAGAAGAGAGAGAAGGAGGG + Intronic
1064567039 10:16650982-16651004 ACGAACAAAAATGTGGAGTATGG + Intronic
1064635240 10:17358589-17358611 AGGAAGAAGGAGGAGAAGGAGGG + Intronic
1064686513 10:17867315-17867337 AGGAAGAAGAAGAAGAAGGAAGG - Intronic
1064700138 10:18010078-18010100 AGAAAGAAAAATGGGGAGGAGGG - Intronic
1065063153 10:21929753-21929775 ATGAACCAGACTGAGGAGGCTGG - Intronic
1065409372 10:25406866-25406888 AAGATCAACAATGAAGAGGAAGG + Intronic
1065667866 10:28082436-28082458 AGGATAAGGAAGGAGGAGGAAGG - Intronic
1065747418 10:28855015-28855037 AGGTAGAAGGATAAGGAGGAAGG - Intronic
1065795041 10:29298843-29298865 ATGAACCAGAGGGAGGAGGATGG + Intronic
1065834534 10:29644841-29644863 GGCTACAAGACTGAGGAGGAGGG + Intronic
1066415080 10:35214266-35214288 AGGGAAAAGAATGAGGAGGAAGG - Intergenic
1067128146 10:43537772-43537794 AGGAAGAAGAAGGAAGAGGAAGG - Intergenic
1067254623 10:44624673-44624695 AGGAACAAGTGTGGGGAGAAGGG - Intergenic
1067557812 10:47284871-47284893 GGGAGGAAGAAGGAGGAGGAGGG + Intergenic
1067557813 10:47284874-47284896 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067557818 10:47284891-47284913 GGGAGGAAGAAGGAGGAGGAGGG + Intergenic
1067557819 10:47284894-47284916 AGGAAGAAGGAGGAGGAGGGAGG + Intergenic
1067787387 10:49260480-49260502 AGGAACTAGAATTAGAAGGAAGG - Intergenic
1067899894 10:50228835-50228857 AGGAAGGAGAAGGAGAAGGAAGG + Intronic
1068887259 10:62110425-62110447 AGGAACAAGGAAGACGAGAAGGG - Intergenic
1069143328 10:64856468-64856490 TGAAACAAGAATGAAGAGAATGG - Intergenic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069718514 10:70535570-70535592 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
1069718519 10:70535590-70535612 AGGAAGAGGAAGGAGAAGGAAGG - Intronic
1069760672 10:70809038-70809060 AGAAACAAGCCTGAGGGGGACGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070976409 10:80609304-80609326 AGGTAAAAGGAGGAGGAGGAAGG - Intronic
1071093286 10:81945270-81945292 AGGAAAAAGAAGGAGGAGGAAGG - Intronic
1071156050 10:82690966-82690988 AAGAAGGAGAAAGAGGAGGAAGG - Intronic
1072898804 10:99389600-99389622 AGGAATAAGAATGAAGGCGATGG + Intronic
1072975024 10:100049997-100050019 AGAAATAAGAATGAGAAGTATGG + Intronic
1073115225 10:101087994-101088016 AGGAAAAGGAAGGAGGAAGACGG + Intergenic
1073294950 10:102433274-102433296 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1073373591 10:103012901-103012923 AGGAAAAGGAAAGAGAAGGAAGG - Intronic
1074126783 10:110534950-110534972 ATGATGAAGAAGGAGGAGGAGGG + Intergenic
1074388448 10:113036252-113036274 AGCAGCAAGAATGTTGAGGATGG - Intronic
1074419922 10:113299732-113299754 AGCCACCTGAATGAGGAGGAAGG + Intergenic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1074804067 10:117029671-117029693 AGGAGCAAGAAGGTGGAGGGAGG - Intronic
1074914006 10:117938419-117938441 AGGCAGAAGAGTGAAGAGGAGGG - Intergenic
1074994978 10:118748945-118748967 AGGAAGAAGAGTCAGGAGGAGGG + Intronic
1074996982 10:118766244-118766266 AGGAACAAAAAAGAGGAGGTTGG + Intergenic
1075602601 10:123781379-123781401 AGGAGCAAGAACAAGAAGGAGGG + Intronic
1075679590 10:124322819-124322841 TGGCACAAGACTGAAGAGGATGG - Intergenic
1075844665 10:125535632-125535654 AGGAAGAAGAAAAGGGAGGAAGG - Intergenic
1076196648 10:128523276-128523298 AGGGACAAGCTTGAGGAGGAAGG - Intergenic
1076896088 10:133312973-133312995 AGGAACAAGGATGGGGAGGATGG - Exonic
1077003840 11:341117-341139 AGGAAAAGGAAAGAGGAGGAAGG + Intergenic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077370763 11:2180566-2180588 AGGAGCAGGAAGGAGGAGGTGGG + Intergenic
1077483855 11:2830008-2830030 AGGAGGAGGAAGGAGGAGGAAGG + Intronic
1078108207 11:8371865-8371887 AGGAAAAATAAAGAGAAGGAGGG - Intergenic
1078550060 11:12274004-12274026 AGGAAGAAGAAAGAGTAGGCTGG + Intergenic
1078634899 11:13040300-13040322 AAGAAAAAGAATGAGAGGGATGG - Intergenic
1078758926 11:14236133-14236155 ACGAACAAGAGTCTGGAGGAAGG + Intronic
1078850966 11:15163320-15163342 AGGGAAAAGAATGAGAAGGAAGG - Intronic
1079243006 11:18733803-18733825 AGGACTCAGGATGAGGAGGAGGG + Intronic
1079310202 11:19358574-19358596 AGGGACAAGAATCAGGATGTTGG + Intronic
1079410280 11:20181097-20181119 AGGAAGAGGGAGGAGGAGGAAGG - Intergenic
1079445567 11:20553668-20553690 AGGAGAAAGAAAAAGGAGGAAGG - Intergenic
1079445572 11:20553706-20553728 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1079468624 11:20757061-20757083 AGAAAGAAGAAAGAGAAGGAAGG - Intronic
1079637763 11:22765953-22765975 AGGAACAAGAGAGAGTGGGAGGG + Intronic
1079711146 11:23683269-23683291 GAGAACTAGAATGAGGAAGACGG + Intergenic
1079754586 11:24240319-24240341 GGGAGCAAGCATGAGAAGGAGGG + Intergenic
1080233091 11:30039931-30039953 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1080894730 11:36439730-36439752 GAGAACAAAAAGGAGGAGGAAGG - Intronic
1080907539 11:36561628-36561650 TAGAACAAAAAGGAGGAGGAAGG + Intronic
1081060593 11:38470572-38470594 AGGATGAAGAAAAAGGAGGAGGG - Intergenic
1081574552 11:44310880-44310902 AGGAACGGGAATGGGGAGGAAGG - Intergenic
1081645837 11:44789856-44789878 AGAGACAAGAATTAGGAGGAGGG - Intronic
1081769937 11:45643677-45643699 AGGAACAAGGGTGAGCAGGTGGG + Intergenic
1082717446 11:56632024-56632046 AGGAAGAAGAATGGGGAGATGGG + Intergenic
1082721820 11:56687139-56687161 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1082733698 11:56831760-56831782 AAATACAAGAAGGAGGAGGAAGG + Intergenic
1082913276 11:58401856-58401878 AAGAACAAAAAGGTGGAGGAAGG - Intergenic
1084347667 11:68566300-68566322 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
1084837873 11:71817306-71817328 AGGAACCAGAAGGGGGAGGCAGG - Intergenic
1084942896 11:72623350-72623372 AGCAACGAGACAGAGGAGGAGGG - Intronic
1084943274 11:72625633-72625655 AGGAACATGAGAGAGGTGGAGGG + Intronic
1084978944 11:72818383-72818405 AGGGACAGGAATAGGGAGGAGGG - Intronic
1085805721 11:79634047-79634069 AAGAACAAGAAAGAGAATGAGGG - Intergenic
1085983644 11:81757009-81757031 AGAAAGAAGAAAGAGAAGGAAGG + Intergenic
1086047294 11:82547881-82547903 AGAAAAAAGAAAGAGGAGGGAGG + Intergenic
1086302509 11:85442919-85442941 AAGAAGAAGAAGGAGGAAGAAGG + Intronic
1086740235 11:90358717-90358739 AAGAAAAAGTATGAGCAGGAGGG - Intergenic
1086827639 11:91519108-91519130 AGAAGAAAGAAGGAGGAGGAAGG + Intergenic
1086944146 11:92828580-92828602 AGGAAAATGTATGAGGAGGTGGG + Intronic
1086998917 11:93392984-93393006 AGAAAGAAGGAGGAGGAGGAGGG - Intronic
1087257378 11:95971549-95971571 GGTGACAAGAATGAGGAAGAAGG + Intergenic
1088429121 11:109738619-109738641 ATGAACATGAATGAGGAAAATGG - Intergenic
1089040220 11:115441171-115441193 AGGTACAAGCATGAGCAGGCAGG - Intronic
1089067297 11:115671428-115671450 ATGAAGAAAAATGAGGAAGAGGG - Intergenic
1089535756 11:119160092-119160114 TTGAACAAGAATGTGGAGGCAGG + Intronic
1090167958 11:124571231-124571253 AGGAAGAGGAAAGAAGAGGAAGG - Intergenic
1090464631 11:126923312-126923334 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090464639 11:126923369-126923391 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090833256 11:130434904-130434926 AGAAACAAGAATAAATAGGAAGG - Intergenic
1091058552 11:132441059-132441081 AGGAAGGAGAGGGAGGAGGAAGG + Intronic
1091074183 11:132599367-132599389 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074185 11:132599377-132599399 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074187 11:132599387-132599409 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074189 11:132599397-132599419 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091074191 11:132599407-132599429 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1091618899 12:2070998-2071020 AGGAAGGAGAAAGAGAAGGAAGG - Intronic
1091618922 12:2071074-2071096 AGGAAGGAGAAAGAGAAGGAAGG - Intronic
1091665608 12:2416411-2416433 AGGAAGAAAAAAGAGAAGGAAGG + Intronic
1091934149 12:4422167-4422189 ATAAACAACAATTAGGAGGAAGG - Intergenic
1092007950 12:5085497-5085519 AGGAAGAGAAATGAGGAGAATGG - Intergenic
1092042345 12:5395771-5395793 AGGAAGAAACATGAGGAAGAAGG - Intergenic
1092069588 12:5621843-5621865 GGGAAAAAGAAGGAGGAAGAGGG + Intronic
1092171120 12:6374695-6374717 GGGAACAAGCGTGAGGAGCAGGG - Exonic
1092283409 12:7114442-7114464 AAGAACAAGGATGAGGACAACGG + Intergenic
1092400828 12:8176767-8176789 AGGAACCAGAAGGGGGAGGCAGG + Intronic
1092481241 12:8860985-8861007 AGGAATACGCATGAGAAGGAGGG - Intronic
1092571059 12:9721719-9721741 ATGAACAAGAAAGAGGAAGCAGG - Intronic
1092579471 12:9822456-9822478 AGGAAAAAGAATGAAAAGGAAGG + Intergenic
1092882691 12:12900265-12900287 TGGGGCAAGAATGAGGATGAGGG + Intronic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093160314 12:15739499-15739521 TGGAACAAAAAGGTGGAGGAAGG + Intronic
1093212138 12:16320624-16320646 AGGAACAAGAATGAGCTTGGAGG - Intergenic
1093508397 12:19896755-19896777 AGGAGGAAGAAGGAGGAAGAAGG - Intergenic
1093508402 12:19896778-19896800 AGGAGAAGGAAGGAGGAGGAAGG - Intergenic
1093771814 12:23026869-23026891 TAGAACAAAAATGTGGAGGAAGG + Intergenic
1093773897 12:23049917-23049939 TTGAACAAAAATGAGAAGGAAGG + Intergenic
1094070298 12:26405159-26405181 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094160603 12:27385959-27385981 ATGCACAGGAATGATGAGGACGG - Intronic
1094232414 12:28122327-28122349 AAGCAGAAGAATGAGGAGGGGGG + Intergenic
1094582709 12:31749163-31749185 AGGCAATAGAGTGAGGAGGACGG + Intergenic
1094628262 12:32146926-32146948 AGGAAGAAGAAGGAGGAGGAAGG - Intronic
1094677900 12:32639054-32639076 AGGAATGAGCATGAGGAGAAGGG + Intronic
1095142132 12:38677015-38677037 AGGAATTATAATGAGCAGGATGG + Intronic
1095172929 12:39056473-39056495 AGCAACAAGATTCAGGAGGACGG + Intergenic
1095261465 12:40104557-40104579 AGGAAAAACAAAGAGGAGAATGG + Intronic
1095480005 12:42625010-42625032 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1095540637 12:43305111-43305133 AGAAAGAAGAAAGAGAAGGAAGG + Intergenic
1095593838 12:43936959-43936981 AGAAAAAAGAATGAGGAGAGAGG + Intronic
1095732455 12:45521002-45521024 TGGAACAAAAAGGAAGAGGAAGG - Intergenic
1095907306 12:47391508-47391530 AGGAAGAAGGATGAGAAGCAGGG + Intergenic
1096087197 12:48873682-48873704 TGGACTAAGAATGAGGAGGGAGG + Intergenic
1096259154 12:50080245-50080267 AGGATGAAGAAGGAGGAGAAAGG - Intronic
1096470082 12:51870067-51870089 AGGAACAAGATTCAGGGTGAGGG - Intergenic
1097677113 12:62614801-62614823 AAGAAAAAGAAGGAAGAGGAAGG - Intergenic
1097689998 12:62725923-62725945 AGGAAGAAAAATCAGAAGGATGG - Intronic
1097825548 12:64171905-64171927 AGGAGCTTGAATGAGGAGGTAGG - Intergenic
1098079330 12:66767291-66767313 GGGATGAAGAGTGAGGAGGAGGG + Intronic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098227685 12:68341525-68341547 AGGAACAGCAAAGATGAGGAAGG - Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098560858 12:71870246-71870268 AGGAAGGAGAAGGAGGAGAAGGG - Intronic
1098684532 12:73401606-73401628 GAGAACAAAAATGTGGAGGAAGG + Intergenic
1099064905 12:77963885-77963907 AGGAAGGAGAAGGAGAAGGAAGG - Intronic
1099064908 12:77963901-77963923 AGGAAGGAGAAGGAGAAGGAAGG - Intronic
1099312611 12:81046643-81046665 AGGAAGAGGAATGTGGAAGAAGG + Intronic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1100507924 12:95238663-95238685 AGCAACAAATCTGAGGAGGAAGG - Intronic
1100525039 12:95411070-95411092 AGGAAGGAGAGTCAGGAGGAGGG - Intergenic
1100550727 12:95644333-95644355 AGGAAGGAGAAGAAGGAGGAAGG - Intergenic
1100759968 12:97796640-97796662 AGAAATAAGAATGAGAAGGGTGG - Intergenic
1100917047 12:99435959-99435981 AGGAAAAAAAATGAGAAAGAAGG - Intronic
1100941649 12:99729305-99729327 AGGAACAAAGATGAGGGTGATGG - Intronic
1100957080 12:99920795-99920817 TAGAACAAGAAAGTGGAGGAAGG - Intronic
1101037706 12:100721471-100721493 AGCAACATGAATGAAGATGAAGG + Intronic
1101188200 12:102304074-102304096 AGGAAAGTGAATGAGGAGCAAGG - Intergenic
1101268092 12:103113357-103113379 AGCAACAAGGAAGAGAAGGAAGG + Intergenic
1101593725 12:106145003-106145025 AGAAACAAGAATGATGACTAAGG + Intergenic
1101794108 12:107957020-107957042 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1101863641 12:108503216-108503238 AGGAATAAGAAAGAGGAGTTGGG + Intergenic
1102027885 12:109723764-109723786 CGGGACAAGATTCAGGAGGAGGG - Intronic
1102167846 12:110820701-110820723 AGGAAGAAGAAGAAGAAGGAGGG - Intergenic
1102167892 12:110820835-110820857 ACGAAGAAGGAGGAGGAGGAGGG - Intergenic
1102230229 12:111257200-111257222 AGGAAGGAGAGGGAGGAGGAGGG - Intronic
1102230389 12:111257695-111257717 AAGATGGAGAATGAGGAGGAAGG - Intronic
1102689690 12:114750611-114750633 AGGAACATGGAAGACGAGGAGGG - Intergenic
1102792313 12:115657774-115657796 AAGAAGGAGGATGAGGAGGAGGG - Intergenic
1102792322 12:115657807-115657829 ACGAGGAAGAAGGAGGAGGAGGG - Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102920013 12:116784855-116784877 AGGGAAAAGAATGAAGTGGAGGG - Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1103252567 12:119512983-119513005 ATGAACAAGAATTGGGAAGAAGG - Intronic
1103590771 12:121990493-121990515 GGAAACAAGCATGAGGAGGAGGG - Intronic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1103971684 12:124676401-124676423 GGAAACAAGAAAGAGGAAGAAGG + Intergenic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104373212 12:128242662-128242684 AGGCCCATGAAGGAGGAGGATGG + Intergenic
1104514533 12:129412514-129412536 TGTAGGAAGAATGAGGAGGAGGG - Intronic
1104854865 12:131896767-131896789 AGGATGAGGAAAGAGGAGGAAGG - Intronic
1105896337 13:24719653-24719675 AAGAAGCAGAAGGAGGAGGAGGG + Intergenic
1106035761 13:26043614-26043636 AGGCAGGAGAATGAGGAGAATGG + Intergenic
1107196806 13:37662007-37662029 AGGATCAAGAAGGAGCTGGAAGG + Intronic
1108068942 13:46607624-46607646 AAGAAGAAGGAAGAGGAGGAAGG - Intronic
1108192755 13:47959425-47959447 AGGAGGGAGAAGGAGGAGGAGGG + Intronic
1108410229 13:50138426-50138448 AAGAAGATGGATGAGGAGGAGGG + Intronic
1108470835 13:50765447-50765469 AGGAAGGAGAAAGAAGAGGAGGG + Intronic
1108490199 13:50974380-50974402 AGGAAAAAGAAAAAGGAGGGAGG + Intergenic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1109106200 13:58253541-58253563 AAGAAGAAAAATGAGGAGGGAGG - Intergenic
1110207986 13:72939906-72939928 AGGAACAAAGATAAGGATGACGG - Intronic
1110297703 13:73887460-73887482 AGGAGCAAGAGAGAGGAGGAAGG - Intronic
1110399293 13:75071045-75071067 AGGAAGCAGAATGAAGAGAAAGG - Intergenic
1111659285 13:91189479-91189501 AGAAAGAAGAAAGAGAAGGATGG + Intergenic
1111961542 13:94816132-94816154 ATGAATAAGAATTAGGAGGAGGG + Intergenic
1112340895 13:98552281-98552303 AGGAACAAGGATGATGGGAAGGG + Intronic
1112682977 13:101788178-101788200 AGGAAAAAAAAAGTGGAGGAGGG - Intronic
1113066042 13:106375109-106375131 AGGAAGAAGAATGGAGAAGAAGG - Intergenic
1113258633 13:108534996-108535018 AGGAAGAGGAAAGAAGAGGAAGG - Intergenic
1113595943 13:111532897-111532919 ACGAAGCAGAGTGAGGAGGAAGG - Intergenic
1113898837 13:113784545-113784567 AAGAAGAAGAAGGAGGAGAAGGG + Intronic
1114038128 14:18648832-18648854 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
1114120485 14:19666204-19666226 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114201219 14:20522569-20522591 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
1114449605 14:22816400-22816422 AGGCAGGAGAATGAGGAGAATGG + Intronic
1114491544 14:23105395-23105417 AGGCACAAGAAATAGGATGAGGG - Intergenic
1114504607 14:23199689-23199711 AGGAAAAATAGTGGGGAGGAAGG + Intronic
1115183154 14:30653672-30653694 AGAAACAAAAATGAGAAGGATGG + Intronic
1115517501 14:34200393-34200415 AGAAAGAAGAAAGAGAAGGAAGG + Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1116645796 14:47527379-47527401 AGGAACAAAAGAAAGGAGGATGG + Intronic
1116966933 14:51024783-51024805 AGGAAGAAAAAAGAGGAAGAAGG + Intronic
1117118692 14:52545728-52545750 AGGAAGAAGAAAGAGGGGAAAGG + Intronic
1117185275 14:53233779-53233801 TGGAACAAGAGAGAGGAGGGAGG + Intergenic
1117195103 14:53331952-53331974 AGCAGAAAGAATGAGGAGAAAGG + Intergenic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117558621 14:56912074-56912096 AGGAACAGGAAGGAGGAAGGAGG - Intergenic
1117667829 14:58076010-58076032 AGGAAGAAGAATAAGAAAGAAGG + Intronic
1117833113 14:59773876-59773898 AGGGTCAAAAATGAAGAGGATGG - Intronic
1118014483 14:61644597-61644619 AGGAACACTGATGAGGTGGAAGG - Intronic
1118209974 14:63756784-63756806 ATGAAAAATAATGAGGAGGCTGG + Intergenic
1118795488 14:69139899-69139921 AGGAGAAAGAAAGAGAAGGAAGG + Intronic
1118892902 14:69924593-69924615 AGGCAGAAGAATGTGGGGGAGGG - Intronic
1119067410 14:71542665-71542687 AGGAAGGAGGAGGAGGAGGAGGG - Intronic
1119382557 14:74238578-74238600 AGCAAACAGAATGAAGAGGAAGG - Intergenic
1119722332 14:76899645-76899667 TAGAACAAGAGTGAGGAGGGCGG + Intergenic
1119913509 14:78373254-78373276 GGGAACAAGAAAGATGAGGTGGG + Intronic
1119933067 14:78566655-78566677 AGAAACCAGAGGGAGGAGGAAGG - Intronic
1119966941 14:78927355-78927377 GGGAACAAGCGTAAGGAGGAGGG + Intronic
1120407631 14:84108794-84108816 AGTAACAAGAGTAGGGAGGAGGG + Intergenic
1120510024 14:85401964-85401986 AGGAAAAAGAATAAAGAGGGAGG + Intergenic
1120511574 14:85421878-85421900 AAGAAGTAGAATGGGGAGGAGGG - Intergenic
1120513380 14:85442208-85442230 AGGAATAAGCAAGAGCAGGAAGG + Intergenic
1120949618 14:90029149-90029171 AGGACCAAGAATCAGAAAGACGG + Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121397214 14:93636738-93636760 GGGAACAGGAATAAGGGGGAGGG - Intronic
1121613128 14:95294669-95294691 AGGAAGATGAAGTAGGAGGAGGG - Intronic
1121735710 14:96216685-96216707 AGGAGGAGGAAGGAGGAGGAAGG + Intronic
1121735723 14:96216730-96216752 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1121892105 14:97603982-97604004 AGCAACAGGAAAGAGGAAGAAGG + Intergenic
1122027817 14:98890168-98890190 AGGAACAAAACAGAGGAGGTGGG + Intergenic
1122371765 14:101233068-101233090 AGGAGCAAGAATGCGCGGGAAGG - Intergenic
1122431495 14:101650938-101650960 ATGAAAAAGAATGAAGAGTATGG + Intergenic
1122703633 14:103606788-103606810 AAGAAAAAGAAAGAGAAGGAAGG - Intronic
1202889555 14_KI270722v1_random:143177-143199 AGGAACCAAAAGGAGGAGGCAGG - Intergenic
1202927122 14_KI270724v1_random:36735-36757 AGAAACAAGAAAGATGAGGAAGG - Intergenic
1123964637 15:25442743-25442765 AGAACCAAGAATGGGGAGGGAGG - Intergenic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1124957740 15:34370796-34370818 AGGAAGAAGAGGGAGGGGGAAGG - Intergenic
1125119810 15:36141853-36141875 AGGAGGAAGAAAGAGGAGGAAGG + Intergenic
1125212568 15:37234293-37234315 AGGAACAAGAGAGAGGAGGTGGG - Intergenic
1125551569 15:40548903-40548925 TGGAACATGAATGAGTGGGATGG + Intronic
1125762912 15:42109946-42109968 AGAAAAAAGGAGGAGGAGGAGGG - Intergenic
1125922532 15:43533938-43533960 AGGAACAGGACTGAGGCAGAAGG + Exonic
1126052326 15:44697275-44697297 AGGAAGAAGAAAGAAGAAGAAGG - Intronic
1126464243 15:48946442-48946464 AGGAAGAGGAAGGATGAGGAAGG - Intronic
1126469314 15:48990768-48990790 AGGCACAAAACTGAGAAGGAAGG - Exonic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126826951 15:52560978-52561000 AGGAACAAAAGGGAGGAAGATGG - Intronic
1126970177 15:54101882-54101904 AAGTATAAGAATGGGGAGGATGG - Intronic
1127006997 15:54581915-54581937 AGGCTCAAGAATGTGGAGGCTGG + Intronic
1127453718 15:59139722-59139744 AGGAGTAATAATGAGGAGGTAGG - Intronic
1127503176 15:59573577-59573599 ATGAACAAGGAAGAGGAAGAGGG + Intergenic
1127706369 15:61551169-61551191 AGGAGCAGGAATGAGGAAGAAGG - Intergenic
1128095653 15:64952663-64952685 AGGAAGAAGAAGAAGGAAGAAGG - Intronic
1128095670 15:64952813-64952835 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1128276221 15:66356263-66356285 GGGAACGAGGATGAGGGGGACGG - Intronic
1128320008 15:66686604-66686626 GGAAAAAAGAATGAGTAGGAGGG + Intergenic
1128339225 15:66808762-66808784 AAGAACAAGAAGCTGGAGGAAGG + Intergenic
1128388751 15:67168652-67168674 AGGCACAAGGAGGAAGAGGAGGG - Intronic
1128527721 15:68423793-68423815 ATCAACAAGAAGGAGGAGGCCGG - Intronic
1128662685 15:69513714-69513736 AGGAACAAGACTGTGGGGGGTGG + Intergenic
1128671379 15:69576896-69576918 AGGGATAGGAAGGAGGAGGAAGG + Intergenic
1128753263 15:70163859-70163881 TGGACCAAGAATTAGGAGGCTGG + Intergenic
1129263571 15:74382256-74382278 AGGAACGGGAATGAAGAGGCAGG + Intergenic
1129275128 15:74440402-74440424 AGGTGCTAGAATAAGGAGGAAGG - Intergenic
1129772429 15:78211181-78211203 AGCAGCAAGAATCAGGAGAAGGG - Intronic
1130031118 15:80315188-80315210 AGAACAAAGAATGATGAGGATGG + Intergenic
1130532802 15:84760298-84760320 ATGAACAAGAAGGAAGAGAAAGG - Intronic
1130847974 15:87765308-87765330 ATGAACAAGACTGAGGATTATGG - Intergenic
1131066390 15:89437263-89437285 AGGTAGAAGAAGGAGGAAGAGGG - Intergenic
1131211867 15:90504463-90504485 AGGCAAAAGAATGAGCAGCAGGG - Intergenic
1131284836 15:91048185-91048207 AAGAAGAAGAAGGAGGGGGAGGG - Intergenic
1131543956 15:93299968-93299990 CGGAACAACACTGAGGCGGAAGG + Intergenic
1131565339 15:93480313-93480335 AGGAACAGGGATGAGAAGAAGGG - Intergenic
1131695385 15:94871654-94871676 AGGAATAACAATGAGAAGAAAGG - Intergenic
1131727438 15:95242590-95242612 AGGAAGGAGAAAGAGAAGGAAGG + Intergenic
1131737397 15:95348365-95348387 AGGTAGAAGAGTGAGAAGGAGGG - Intergenic
1131744725 15:95434853-95434875 AGGAAGAAGAAAAAGAAGGAAGG - Intergenic
1131771199 15:95739470-95739492 AGGGAGAAGAATGAGGAGCATGG + Intergenic
1131901065 15:97088523-97088545 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901083 15:97088587-97088609 AGGAAAGAGGAGGAGGAGGAAGG - Intergenic
1131901091 15:97088616-97088638 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1131901094 15:97088626-97088648 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1131901098 15:97088639-97088661 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131901103 15:97088655-97088677 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131996715 15:98140361-98140383 AGGAAGCAGAAAGAAGAGGAGGG - Intergenic
1131997195 15:98144162-98144184 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
1132078629 15:98845479-98845501 AGGAGAAGGAAGGAGGAGGAGGG - Intronic
1132095667 15:98982666-98982688 AATAACCAGAGTGAGGAGGAAGG - Intronic
1132159580 15:99526291-99526313 AGGAACAATGATAAGAAGGATGG - Intergenic
1132295592 15:100731998-100732020 ATGAACAAGGATGAGGAACATGG + Intergenic
1133205158 16:4228811-4228833 GGGAACAAGAGTGAGGAGACTGG - Intronic
1133392735 16:5422702-5422724 AGGAAAGAGAAAGAGGAGGAGGG + Intergenic
1133437722 16:5794238-5794260 AGGAAAAAGAAAGGGGAAGAAGG - Intergenic
1133554076 16:6887961-6887983 AGTAATAAAAATGATGAGGATGG - Intronic
1133634129 16:7650099-7650121 AGGAGCAAGTATAAGAAGGAAGG + Intronic
1133969552 16:10557928-10557950 AGGAACAAGAGGGAGGAGAAAGG + Intronic
1134287182 16:12872038-12872060 AGGAAGAAGAAGGAGGAGGGGGG - Intergenic
1134336100 16:13300912-13300934 AGAAAGAAGAAGGAGGAGGTGGG - Intergenic
1134649573 16:15898111-15898133 AAGAAGATGAAAGAGGAGGAGGG - Intergenic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134884189 16:17775395-17775417 AGGAAGATGAATGGGGAGGAGGG - Intergenic
1134896930 16:17896673-17896695 AGGAAAAAGAAAAAGGAGAAAGG + Intergenic
1134913644 16:18051134-18051156 AGAAACAAGAGTGCTGAGGAAGG - Intergenic
1135432967 16:22402250-22402272 AAGAATAAAAATGAGGGGGATGG - Intronic
1135481996 16:22828344-22828366 TGGAACAAGAATGAGCAGCAGGG - Intronic
1135807704 16:25557593-25557615 AGAAAAAAGAATGAAAAGGAAGG + Intergenic
1135874664 16:26187102-26187124 AGGAACAAGAGAGAGAATGAGGG - Intergenic
1136138833 16:28275945-28275967 AAAAGAAAGAATGAGGAGGACGG + Intergenic
1136187724 16:28597845-28597867 AGGACAAAGAACGAGGAGGGTGG - Intergenic
1136190205 16:28610825-28610847 AGGATAAAGAACGAGGAGGATGG - Intronic
1136318714 16:29468724-29468746 AAGACAAAGAATGAGGAGGGTGG + Intergenic
1136433286 16:30208068-30208090 AAGACAAAGAATGAGGAGGGTGG + Intronic
1136452170 16:30359609-30359631 AAGAGCAAGAACAAGGAGGAGGG + Intronic
1136539100 16:30918720-30918742 AGGAGGAAGGAGGAGGAGGAAGG - Intergenic
1136539109 16:30918756-30918778 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1136599359 16:31274313-31274335 AAGAAAAAGAAAGAGGAGAAAGG + Intronic
1137459535 16:48648007-48648029 AGAAAGAAGAAAGAGAAGGAGGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137811673 16:51358622-51358644 AGGGCCAAGAAAGAGGATGAAGG + Intergenic
1137968358 16:52959108-52959130 AAGAAGAAAAAGGAGGAGGAGGG - Intergenic
1138126162 16:54440461-54440483 AGGAGGAGGAAGGAGGAGGAGGG - Intergenic
1138153944 16:54685793-54685815 AGGAAGAAGGAGGAGGAGAAAGG - Intergenic
1138153952 16:54685826-54685848 AGGAAGAAGGAAGAGGAGGAGGG - Intergenic
1138264175 16:55647638-55647660 AGAAAAAAGAAAGAGAAGGAAGG + Intergenic
1138305613 16:55971840-55971862 AGGAACCAAAAGGAGGAGGCAGG + Intergenic
1138309021 16:56007282-56007304 AGGAACAGTATTGAGGAAGATGG - Intergenic
1138491248 16:57378078-57378100 AGCAAGAAGAGTAAGGAGGAGGG - Intronic
1139162639 16:64529625-64529647 AGGAAAGAGAAAGAGAAGGAGGG + Intergenic
1139330325 16:66183570-66183592 AGGAGGAGGAAGGAGGAGGAAGG + Intergenic
1139330328 16:66183580-66183602 AGGAGGAGGAAGGAGGAGGAAGG + Intergenic
1139424995 16:66873873-66873895 AGGAGGAGGAAGGAGGAGGAGGG - Intergenic
1139447914 16:67009555-67009577 AGGCACAAGGTTGAGCAGGATGG - Exonic
1139457576 16:67094252-67094274 AGGAACAAAAATGAGGGGCCCGG - Intronic
1139559145 16:67730552-67730574 AGGTGCCAGCATGAGGAGGATGG - Intronic
1139946330 16:70644909-70644931 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
1139946334 16:70644925-70644947 AGGAAGGAGGAAGAGGAGGAAGG + Intronic
1140372511 16:74420945-74420967 AGGAGGAGGAAGGAGGAGGAAGG - Intronic
1141294134 16:82751037-82751059 AAGATCAGGAAGGAGGAGGATGG - Intronic
1141693267 16:85608167-85608189 AGGAAACAGAAAGAGGAGGGTGG + Intergenic
1141775724 16:86121618-86121640 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1141775746 16:86121705-86121727 AGGGACAAGGATGAGGAGGAAGG - Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141775807 16:86121912-86121934 AGGGACAGGGAGGAGGAGGATGG - Intergenic
1141775829 16:86121976-86121998 AGGGACAAGGAGAAGGAGGAGGG - Intergenic
1141845116 16:86603371-86603393 AGGAAGAAGGAGGAGGGGGAAGG - Intergenic
1142066503 16:88065918-88065940 AGGGACAGGAAGGAGGTGGAAGG - Intronic
1142682854 17:1560665-1560687 AGGAAAAAGAATCAGAAGGATGG + Intronic
1142964256 17:3571178-3571200 AGGAACAGGGCTGAGGAGGCAGG + Intronic
1143091260 17:4450243-4450265 AGGAGGAAGGAGGAGGAGGAGGG - Intronic
1143325275 17:6094566-6094588 AGGAAAAGGAAGGAGAAGGAAGG + Intronic
1143355701 17:6326408-6326430 GGGAACAAGAATGACTAGGAAGG + Intergenic
1143395409 17:6590998-6591020 AGGAAGAAGAAGGAAGAAGAAGG + Intronic
1143749578 17:9018657-9018679 AGAAACAACATTCAGGAGGAAGG + Intergenic
1143763394 17:9121090-9121112 AGGAAAAAGAAGGAAGCGGATGG + Intronic
1143794687 17:9327206-9327228 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1143794699 17:9327250-9327272 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1143840269 17:9726228-9726250 AGGCAAAAGAATGAGGTGCAGGG - Intronic
1144090185 17:11849418-11849440 GGGAAGAAGTATGAGGAGTATGG - Intronic
1144102833 17:11959215-11959237 ATGAACAAAAGTGATGAGGATGG - Intronic
1144289622 17:13813906-13813928 AGGAAGAAATGTGAGGAGGACGG + Intergenic
1144307547 17:13982993-13983015 GGGGGCAGGAATGAGGAGGAGGG + Intergenic
1144349831 17:14384549-14384571 AGCTACAAGAAAGAGGAGGTGGG + Intergenic
1144390384 17:14788180-14788202 AAGAACAGCAATGAAGAGGATGG - Intergenic
1144967346 17:19086028-19086050 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1144980573 17:19166038-19166060 AAGGAGAAGGATGAGGAGGAGGG - Intergenic
1144987649 17:19212195-19212217 AAGGAGAAGGATGAGGAGGAGGG + Intergenic
1145280597 17:21464331-21464353 AGGAGCAGGAAGGAGCAGGAGGG + Intergenic
1145735007 17:27222755-27222777 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
1145831083 17:27916892-27916914 AGAAAGAAGAGTGAGGAGGAAGG + Intergenic
1145902138 17:28496145-28496167 AGGAACACGCCTGGGGAGGAAGG - Intronic
1146212600 17:30954064-30954086 AGCAACAAGAACCAGGCGGAGGG - Intronic
1146470070 17:33117152-33117174 AGGAAGAAGAATGAGGAATGAGG - Intronic
1146622458 17:34409659-34409681 AAGAACAAGAATGATGAGTGAGG + Intergenic
1146673679 17:34758586-34758608 AGGAGAAAGAAGAAGGAGGAAGG + Intergenic
1147165932 17:38593306-38593328 AGGAACAGGGTTGGGGAGGAAGG + Intronic
1147254795 17:39175221-39175243 CGCAACAAGAATGAGCTGGAGGG - Exonic
1147498808 17:40942517-40942539 AGAAGGAAGAAGGAGGAGGAGGG - Intergenic
1147498849 17:40942749-40942771 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1147498859 17:40942810-40942832 AGAAGGAAGAAGGAGGAGGAGGG - Intergenic
1147917968 17:43900038-43900060 AGGAACAGGAGTGGGGAGGAGGG + Intronic
1148355168 17:46970763-46970785 AGGTACAAGCCTGAGAAGGATGG + Intronic
1148459880 17:47833370-47833392 AGGAAGAAGGAGGAGGAAGAAGG - Intronic
1148514108 17:48199988-48200010 AAGAATTAGATTGAGGAGGAAGG + Intronic
1148596856 17:48863435-48863457 AACACCAAGGATGAGGAGGAAGG - Exonic
1148789011 17:50162839-50162861 AGGAACGAGAAAGAGAAGGGAGG + Intergenic
1148804295 17:50256555-50256577 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1149066435 17:52485983-52486005 AGGAAGACGAAAGAGGAAGATGG - Intergenic
1149107109 17:52982657-52982679 AAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1149148521 17:53530507-53530529 AGAAAGAAGAAAGAGAAGGAAGG + Intergenic
1149273157 17:55004707-55004729 AGAAAGGAGAAGGAGGAGGAGGG + Intronic
1149534425 17:57421524-57421546 AGGAGAATGAATGGGGAGGAGGG - Intronic
1149612464 17:57967632-57967654 AGGGAGAAGAATGGGGAGGGGGG - Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1150509614 17:65736601-65736623 GGGAACAAGAATGGGAAAGAGGG + Intronic
1150719504 17:67602470-67602492 AGGAAAAGGAATGAGGAGGCTGG + Intronic
1150890545 17:69144248-69144270 AGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1151157073 17:72132600-72132622 GGGAATAAGAATGGAGAGGATGG + Intergenic
1151197369 17:72441207-72441229 AGAGACAGGAAGGAGGAGGAAGG - Intergenic
1151825991 17:76524661-76524683 AGGTACGAGGAGGAGGAGGATGG - Intergenic
1152000090 17:77639931-77639953 AAGAGGAAGAAGGAGGAGGAGGG - Intergenic
1152328569 17:79657134-79657156 GAGGAGAAGAATGAGGAGGAAGG + Intergenic
1152731672 17:81975103-81975125 AAGAAGAAGAGGGAGGAGGAAGG - Intergenic
1152984132 18:306666-306688 AGGAACCAGAAGGAGGAGGCAGG - Intergenic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153299133 18:3577299-3577321 AGGAACAAGAAGGAAAAGGTGGG - Intronic
1154031228 18:10756000-10756022 GGGATGGAGAATGAGGAGGAGGG + Intronic
1154031305 18:10756382-10756404 AGGATGAAAGATGAGGAGGACGG + Intronic
1154031340 18:10756582-10756604 AGGATGAAAGATGAGGAGGAGGG + Intronic
1154031492 18:10757286-10757308 AGGAGTAAGAATGGGGATGAGGG + Intronic
1154044271 18:10889755-10889777 AGGGAGGAGAATGAGGATGAGGG - Intronic
1154056328 18:11016051-11016073 AGGAGGAAGAATGAGGCTGAAGG - Intronic
1154375386 18:13804806-13804828 AGGAAACTGAATGAGGAGGTAGG + Intergenic
1155030284 18:21978349-21978371 AGGAACCAGAAAAAGGAGGAGGG - Intergenic
1155066581 18:22273889-22273911 AGGAGGAGGAAGGAGGAGGAGGG - Intergenic
1155472491 18:26205469-26205491 AGGAAGAAGAAAGAAGAAGAAGG + Intergenic
1156481154 18:37437216-37437238 AGAAAGAAGAATGAGAAGGCAGG + Intronic
1156735273 18:40250030-40250052 AAAAAAAAGAATGATGAGGATGG + Intergenic
1156895792 18:42244144-42244166 AGGAAAGAGATTGTGGAGGATGG - Intergenic
1157382017 18:47227145-47227167 AGGAGGAAGAAGGAGGAAGATGG - Intronic
1157528627 18:48404379-48404401 AGAAACAAAAAGGAGGTGGAAGG + Intronic
1157750796 18:50176318-50176340 AGGGACAAGAGTGAGAAGGAAGG - Intronic
1157768650 18:50325088-50325110 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768653 18:50325098-50325120 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768656 18:50325108-50325130 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768659 18:50325118-50325140 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768662 18:50325128-50325150 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1157768665 18:50325138-50325160 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1158572363 18:58607533-58607555 AGCAACAGGGATGAGGATGATGG + Intronic
1158786000 18:60712467-60712489 AGGAACTAGAATTAGGAGAAGGG + Intergenic
1158826061 18:61221033-61221055 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
1159119944 18:64157096-64157118 AGGAAGATGACTGTGGAGGAAGG - Intergenic
1159271240 18:66153814-66153836 AAGACGAAGAAGGAGGAGGAGGG + Intergenic
1159847827 18:73486994-73487016 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1159982858 18:74807203-74807225 AGGAACGTGAATGATGAGAAAGG + Intronic
1160135305 18:76266375-76266397 AGGAAGAGGAAGGAGAAGGAAGG + Intergenic
1160135317 18:76266420-76266442 AGGAAGAGGAAGGAGAAGGAAGG + Intergenic
1160448662 18:78947074-78947096 AGGAAGAGGAAGGAGGAGGAGGG + Intergenic
1160925361 19:1542280-1542302 AAGAAAAAGAAGGAGAAGGAAGG - Intergenic
1160965298 19:1744688-1744710 AGGGAAAAGGATGAGGAAGAAGG - Intergenic
1161404042 19:4081925-4081947 AGGAGCAAGAAGGAGGAGGAGGG - Intergenic
1161604936 19:5209531-5209553 TGGTACAAGATTGAGGAAGATGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161800575 19:6415101-6415123 AGGAGAAAGGAGGAGGAGGAGGG + Intronic
1161801626 19:6419470-6419492 AGGGAAAAGGATGAGGTGGAGGG + Intronic
1161803551 19:6429528-6429550 AGGAGGAGGAAAGAGGAGGAGGG + Intronic
1161960115 19:7518492-7518514 AGGAAGAAGAGAGAGAAGGAAGG + Intronic
1161982168 19:7635709-7635731 ACAAACAAAAATGGGGAGGAGGG + Intronic
1162080783 19:8216416-8216438 AGGAAAAGGAATGAGGAGTCAGG - Intronic
1162339212 19:10081755-10081777 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1163061288 19:14763975-14763997 AGGAAGAAAAAGGAGGAAGAGGG - Intronic
1163105781 19:15122435-15122457 AGGGAAAAGGAGGAGGAGGAGGG + Intronic
1163124213 19:15235944-15235966 AGGAACAAAAATGAGTGGGTGGG + Exonic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163779540 19:19239351-19239373 AGGGAAAGGAAGGAGGAGGAGGG - Intronic
1163779766 19:19240107-19240129 GGGAAGAAGGATGGGGAGGAGGG - Intronic
1164296036 19:23910923-23910945 AGGAAGGAGAAAGAGGAAGAAGG + Intergenic
1164591913 19:29512082-29512104 GAGAGCAAGGATGAGGAGGAAGG + Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1164592072 19:29512663-29512685 AGGAAGGGGGATGAGGAGGAAGG + Intergenic
1164592497 19:29514194-29514216 AGGAGGAGGGATGAGGAGGAAGG + Intergenic
1164860865 19:31561211-31561233 AGAAACAAAAATCAGGAGGCTGG - Intergenic
1165155097 19:33782042-33782064 AGGATCCAGAATGAGGCTGAGGG + Intergenic
1165249896 19:34521840-34521862 AGGAGAAAGAGAGAGGAGGAAGG - Intergenic
1165344976 19:35239741-35239763 AGGAACAAGAATGGAGCTGAAGG - Intergenic
1165416035 19:35694098-35694120 AGGAGGAAGGAAGAGGAGGAGGG - Intergenic
1165468769 19:35990826-35990848 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468771 19:35990836-35990858 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468773 19:35990846-35990868 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165468775 19:35990856-35990878 AGGAGGAAGAAGGAGGAAGAAGG + Intergenic
1165724200 19:38101115-38101137 ATGTACAACAATGAGGAGGCCGG + Exonic
1166024835 19:40072666-40072688 AAAAAGAAGAATGAGGAGAAAGG + Intronic
1166590458 19:43993129-43993151 AGGGGGAAGAATGAGGATGAGGG + Intronic
1166604486 19:44128167-44128189 AGAAAGAAGAATGAGGATAAGGG + Intronic
1166652145 19:44582693-44582715 AGGAGGAAGAAGGAGAAGGAGGG + Intergenic
1167083986 19:47296538-47296560 AGAAAGAAGAAAGAGAAGGAAGG - Intronic
1167144623 19:47674231-47674253 AGGAACAGGAAGGAGGCTGATGG + Intronic
1167214236 19:48153871-48153893 AAGAGGAAGAAGGAGGAGGAAGG - Exonic
1167258653 19:48445069-48445091 AAGACCAAGAAAGAGGAGGTGGG + Intergenic
1167337917 19:48897874-48897896 AGAAGCAAGAATGAGGAGTCAGG + Intronic
1167608143 19:50492726-50492748 AGGAAGAGGAAAGAGGAGGAAGG + Intergenic
1167793108 19:51692715-51692737 AGGACCAGGGATGAGGGGGAGGG - Intergenic
1168400468 19:56083332-56083354 AGGAAGAAGAATGAGGAATTTGG + Intergenic
1168643451 19:58044974-58044996 AAGAACAAGAAGCTGGAGGAAGG + Intronic
1202664959 1_KI270708v1_random:109946-109968 AGGAACCAAAAGGAGGAGGCAGG - Intergenic
1202697537 1_KI270712v1_random:135847-135869 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
925402566 2:3586028-3586050 AGGAAAAAGGAGGAGGGGGAAGG + Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925689511 2:6506620-6506642 AGGAACAAGAAGGAGGAAAGGGG + Intergenic
925998110 2:9308296-9308318 AGGGGCAAGAATGAGGCGGGAGG + Intronic
926233018 2:11019106-11019128 AGGAAGAAGAAAAAGGAGGTGGG - Intergenic
926266838 2:11330873-11330895 AGGAAGAGGAATGAGGAGGAGGG + Intronic
926266844 2:11330896-11330918 AGGAGGAAGAGAGAGGAGGAGGG + Intronic
926266876 2:11330978-11331000 AGGAGAAGGAAAGAGGAGGAGGG + Intronic
926294963 2:11562490-11562512 AGGAAGAAGAGGGAGAAGGAGGG + Exonic
926316882 2:11716333-11716355 AAAACCAAAAATGAGGAGGAAGG + Intronic
926327320 2:11796656-11796678 AGGCACAAGAAAGAATAGGAAGG + Intronic
926394847 2:12430403-12430425 AGGAAGGAGAAGAAGGAGGAAGG + Intergenic
926433121 2:12809989-12810011 AGGAACAAGTGTGAACAGGAAGG + Intergenic
926885981 2:17599214-17599236 AGGAACAGGAAAGACAAGGAAGG + Intronic
926887696 2:17613040-17613062 AGGACAAAGAAGGATGAGGATGG - Intronic
926918515 2:17916352-17916374 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
926940886 2:18135401-18135423 AGGAACAAGAGTTGGGAGGATGG + Intronic
927028581 2:19096406-19096428 AGGAAGAAGAAGGTGGAAGAAGG + Intergenic
927702903 2:25279212-25279234 AGGAGAAAGAATCAGGAAGACGG - Intronic
927878279 2:26673391-26673413 GAGAACAAGAATCAGGAGAAGGG + Intergenic
928127058 2:28624204-28624226 AGGGACAGGAAGGAGCAGGAGGG - Intronic
928248835 2:29656832-29656854 AGGATGGAGAATGAGGAGCAAGG - Intronic
928357107 2:30627402-30627424 AGGAAACAGAATGTAGAGGAGGG - Intronic
928429137 2:31203490-31203512 AGGAATAAGAAGGAGGAATAGGG - Intronic
928854308 2:35785822-35785844 ATGGACAAGAATGAGGAACAGGG + Intergenic
929015018 2:37485283-37485305 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
929361605 2:41098569-41098591 GAGAAAATGAATGAGGAGGAGGG - Intergenic
929458647 2:42085019-42085041 GGGAAGAAGAATAAGGAGGAGGG + Intergenic
929651673 2:43686151-43686173 AGGAAGAAGGAAGAGGAAGAAGG - Intronic
929792063 2:45030714-45030736 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930581855 2:53221074-53221096 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
930590310 2:53319351-53319373 TGGAACAAGAAAGACCAGGAAGG + Intergenic
930828421 2:55717318-55717340 AGAAACAGGAATGGAGAGGAGGG + Intergenic
930840943 2:55844653-55844675 AGGAAGAGGAAGGAGAAGGAGGG - Intergenic
931032183 2:58189119-58189141 AGGGACAATAATGAGGAAGGAGG + Intronic
931099169 2:58976098-58976120 AGAAAGAACAATGAGGAGGAGGG + Intergenic
931129519 2:59318465-59318487 AACAAGAAGAATAAGGAGGAGGG + Intergenic
931176909 2:59863394-59863416 AGGAACAGGAAAGAGAAGGTGGG - Intergenic
931300756 2:60975737-60975759 AAGAAAAAGAATGAGGCTGAAGG - Intronic
931330072 2:61271670-61271692 AGAAAGAAGAAAGAGGAGAAAGG + Intronic
931476569 2:62593887-62593909 TAGAACAAAAATGTGGAGGAAGG + Intergenic
931799296 2:65742832-65742854 AGGAGTAAGAATATGGAGGAGGG + Intergenic
931981370 2:67696775-67696797 AGGGACGAGAAGGGGGAGGAAGG + Intergenic
932201257 2:69830094-69830116 ACGGACGAGGATGAGGAGGAGGG + Exonic
932208156 2:69902268-69902290 AGGAGGAAGGAGGAGGAGGAAGG - Intronic
932208162 2:69902288-69902310 AGGAGGAAGAAGGAGGAGGAAGG - Intronic
932426689 2:71642085-71642107 AGGAACAAGAATTGTGGGGAAGG - Intronic
932451497 2:71813484-71813506 AGGAACAAGAAGGAGCAGGTGGG + Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932736962 2:74261004-74261026 AGGAGCAAGGAGGAGGAAGAGGG - Intronic
932929026 2:76011749-76011771 AGGAACAAAAAGGGGGAGGCAGG + Intergenic
932993136 2:76812797-76812819 AGGAAGAATAAGGAGGAGGAGGG - Intronic
933050840 2:77599960-77599982 AGAAATCAGAAAGAGGAGGAAGG - Intergenic
933069296 2:77836924-77836946 AGGAAGGAGAAAGAGAAGGAAGG + Intergenic
933069312 2:77836986-77837008 AGGAAGAAGAGAGAGTAGGAAGG + Intergenic
933069349 2:77837121-77837143 AGGAAGAAGAGAGAGAAGGAAGG + Intergenic
933187451 2:79293753-79293775 AGAAACAGGAATGAGTATGAGGG + Intronic
933281290 2:80335375-80335397 AGAAAGAGGAGTGAGGAGGAAGG + Intronic
933539133 2:83616727-83616749 AGGAGCAAGAGAGAGGAGGGAGG - Intergenic
933594680 2:84271482-84271504 AGGAACCAGGATGAGGCAGATGG - Intergenic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
934165507 2:89290493-89290515 AGGAAGAAATATGAGGAGGCAGG - Intergenic
934201768 2:89891969-89891991 AGGAAGAAATATGAGGAGGCAGG + Intergenic
934278709 2:91592871-91592893 AAGAAGAAGAGGGAGGAGGAGGG - Intergenic
934535325 2:95128610-95128632 AGAAAGAAAAAGGAGGAGGAGGG + Intronic
934535342 2:95128707-95128729 AGGAGAAAGAAGGAGGAGGGAGG + Intronic
934653267 2:96104233-96104255 AGGGAGAGGAAGGAGGAGGAGGG - Intergenic
934865708 2:97808515-97808537 TGAAACAAGTATGGGGAGGAGGG - Intronic
934979893 2:98831098-98831120 GGGAGAAAGGATGAGGAGGATGG - Intronic
935026428 2:99281625-99281647 AAGAAAGAGAATGAGGAGAAGGG + Intronic
935150817 2:100433560-100433582 AAGAACAAAAATGTGGAGGAAGG + Intergenic
935248155 2:101237253-101237275 AGGAAAAAGAAGAAGGAAGAAGG + Intronic
935367116 2:102306328-102306350 AAGCAAAAGAATGATGAGGAAGG + Intergenic
935531665 2:104240362-104240384 AGGGAGGAGGATGAGGAGGAGGG + Intergenic
935531674 2:104240388-104240410 AGGAAGAGGGAGGAGGAGGAGGG + Intergenic
935801765 2:106704587-106704609 AGGAAAGAGGATCAGGAGGAAGG - Intergenic
936168702 2:110148261-110148283 AGGAGCAAGAAGGAGGAAGGAGG - Intronic
936601101 2:113895443-113895465 ATGAACAAGAATTAGGAGTATGG + Intronic
936731294 2:115384457-115384479 AGGAAGAAGAAGGAAGAAGAAGG + Intronic
937123059 2:119454041-119454063 AGGACAAAGACTGAGAAGGAAGG + Intronic
937217311 2:120321111-120321133 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
937217320 2:120321140-120321162 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
937217378 2:120321297-120321319 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
937217383 2:120321313-120321335 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
937217388 2:120321329-120321351 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
937310476 2:120899713-120899735 AGCCACAAGAAAGAGGAAGATGG - Intronic
937310561 2:120900219-120900241 AGGAACAAGAAAGAGCCGGAAGG - Intronic
937323665 2:120975991-120976013 GGGAACAGGCAGGAGGAGGAAGG - Intronic
937358961 2:121215842-121215864 GGGAACAAGAAAGAGGGAGAAGG - Intergenic
937483099 2:122283199-122283221 AGGAAGAAGAAAAAGGGGGAGGG - Intergenic
937701980 2:124873194-124873216 AGGAAGAAGAGCGAGGAGGAAGG + Intronic
937840228 2:126518054-126518076 CAGAACAAGCATGAGAAGGAAGG + Intergenic
937842103 2:126534432-126534454 AGGAACAAGAGAAAGGAGGGTGG + Intergenic
937928975 2:127190295-127190317 AGTACCAGGAATGAGCAGGAAGG - Intronic
938004086 2:127773411-127773433 AATAACAACAAGGAGGAGGAGGG + Intronic
938214122 2:129493796-129493818 AAGAAAAAGAATGAAGAAGAAGG + Intergenic
938225753 2:129614714-129614736 AAGAACAGGAAGGAGGAGGGGGG + Intergenic
938301968 2:130221755-130221777 TAGAACAAGAAGGTGGAGGAAGG + Intergenic
938454733 2:131452697-131452719 TAGAACAAGAAGGTGGAGGAAGG - Intergenic
938688611 2:133765532-133765554 AAGAACAAGAATTAGAAAGAAGG + Intergenic
938944039 2:136194611-136194633 AGAAGCAGGAATGAGGATGAGGG + Intergenic
939115655 2:138057366-138057388 AGGAAAAAGAAAGAGAAGGAAGG - Intergenic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939280071 2:140052541-140052563 GAGAAGAAGAAAGAGGAGGAAGG + Intergenic
939587334 2:144020984-144021006 AAAAACAAAAATAAGGAGGATGG + Intronic
939765105 2:146238595-146238617 AGCAGCAAAAATGAGGAGGGAGG + Intergenic
939966951 2:148619639-148619661 GGGAAAAAGGAGGAGGAGGAGGG - Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940179678 2:150918420-150918442 AGGAAAAGGAAGGAGAAGGAAGG + Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942524791 2:176841746-176841768 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
942524806 2:176841798-176841820 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
944019315 2:195082411-195082433 AAGAAGAAAAAAGAGGAGGAAGG - Intergenic
944213883 2:197234603-197234625 ATTAAAAAGAATGAGGTGGATGG - Intronic
944395750 2:199264071-199264093 AGGAAGAAGGAACAGGAGGAAGG + Intergenic
945058105 2:205885654-205885676 AGGAAGGAGAATGACGGGGAAGG + Intergenic
945307066 2:208268727-208268749 AGGAAGAAGAAGGGGAAGGAAGG - Intronic
945379285 2:209120423-209120445 AGGATCGAGAGTGATGAGGAGGG + Intergenic
945431462 2:209770975-209770997 AGGAAGAAGGAGAAGGAGGAGGG + Intergenic
945509649 2:210685192-210685214 AGGAGGAAGAAAGAGAAGGAGGG + Intergenic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
946328830 2:218998672-218998694 AGGAACCAGGGTGAGAAGGAGGG - Intergenic
946592166 2:221262605-221262627 AGGAACAAGGAAGAGAAGAAAGG - Intergenic
946724644 2:222650444-222650466 ACCAGCAAGAATGAGGAAGAAGG + Intronic
946758873 2:222973451-222973473 AGGTAAAAGGCTGAGGAGGAGGG + Intergenic
946876890 2:224138469-224138491 AGGAACAAGAGTGAGGAGGGAGG + Intergenic
946899120 2:224355381-224355403 AGAATGAAGAATGAGGAGGATGG - Intergenic
947281190 2:228457088-228457110 AAAAAAAAAAATGAGGAGGAGGG - Intergenic
947617773 2:231569289-231569311 AGCTACAAGAAGGAGGAGTAAGG + Intergenic
947760955 2:232603457-232603479 AGGAGGAGGAAAGAGGAGGAAGG + Intergenic
948020337 2:234727217-234727239 AGAAAGAAGAATGAGAAAGATGG + Intergenic
948034884 2:234850398-234850420 AGGAGCAAGACAGAGGAGGAAGG + Intergenic
948091951 2:235302225-235302247 AGGAGGAAGAGGGAGGAGGAGGG - Intergenic
1169286038 20:4308082-4308104 AGGAGCAAGAGAGAGGAGGGAGG + Intergenic
1169765571 20:9144655-9144677 AGAAAGAAGGAGGAGGAGGAGGG + Intronic
1170715783 20:18829687-18829709 AGGGACAAGAAAGAGGAGAAGGG - Intronic
1170730374 20:18969754-18969776 AGGAACAGGAAAGATGAAGAAGG - Intergenic
1170902323 20:20477086-20477108 ACGAGCAAGAATTAGGAGGCTGG + Intronic
1171074686 20:22110611-22110633 AGGAAAGAGGAAGAGGAGGAGGG - Intergenic
1171074695 20:22110648-22110670 AGGAAAGAGGAAGAGGAGGAGGG - Intergenic
1171351988 20:24509993-24510015 AGGAACAAGAGTGAGCGGGGAGG - Intronic
1171781455 20:29422456-29422478 AGAAACAAGAAAGATGAGGAAGG + Intergenic
1172036115 20:32011818-32011840 GGGGACAAGAATGAGGCAGATGG + Intronic
1172352621 20:34255263-34255285 AGGAACAGGATTGAGAACGAGGG - Intronic
1172623697 20:36335652-36335674 GGGAACAAGAGGGAGGAAGAAGG - Intronic
1172635953 20:36410073-36410095 AGGAACAGGAACAAGGTGGATGG - Intronic
1172689003 20:36777798-36777820 AGGGGCCAGGATGAGGAGGAAGG + Exonic
1173121430 20:40293337-40293359 AGGAAAAAAACTGAGGAAGAGGG + Intergenic
1173317634 20:41959397-41959419 AGGAAAGAGATTGATGAGGAGGG - Intergenic
1173448864 20:43144380-43144402 AGGAGGAAGAATGAATAGGAAGG - Intronic
1173670643 20:44796405-44796427 AGGAAATAGAGTGGGGAGGAAGG + Intronic
1174407282 20:50310554-50310576 AGCCACAAGAGTGAGGAAGAGGG + Intergenic
1174641771 20:52050472-52050494 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1174898559 20:54475550-54475572 AGGAGGAGGAAAGAGGAGGAAGG - Intergenic
1175005527 20:55678327-55678349 AGGGACACAAATGAGGGGGAGGG - Intergenic
1175298903 20:57928861-57928883 GGAGACAAGAAGGAGGAGGAGGG - Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175327790 20:58141812-58141834 AGGAAATAGAATGATGGGGATGG - Intergenic
1175375106 20:58518776-58518798 AGGGACAAGGATGAAGAGGTAGG - Intergenic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1176293639 21:5059280-5059302 TGGCAGATGAATGAGGAGGAGGG + Intergenic
1176901962 21:14453103-14453125 AGGAACACTAATGAGGAGCCAGG + Intergenic
1176918982 21:14663630-14663652 AAGGACCAGAAGGAGGAGGAAGG + Intergenic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1177655322 21:24009516-24009538 AAGAGCAAGAATTAGGTGGATGG + Intergenic
1177741383 21:25158444-25158466 AGGAAGAAAAAAGAGAAGGAAGG + Intergenic
1178040740 21:28638344-28638366 AGGAACTGGAAGGAGGAGCACGG + Intergenic
1178643204 21:34363351-34363373 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178643205 21:34363361-34363383 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178643206 21:34363371-34363393 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1178795208 21:35737712-35737734 AGAGACTAGAATGAGGAGGGTGG - Intronic
1178940009 21:36897734-36897756 AGGTACAAGGAGGAGAAGGAAGG + Intronic
1179075324 21:38115000-38115022 AGGAACAGGAATGAGGATTGGGG + Intronic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179121541 21:38550411-38550433 AGGTAGCAGTATGAGGAGGAGGG + Intronic
1179224154 21:39438069-39438091 ATGAACAAAAATGATGAGAAGGG + Intronic
1179238311 21:39566557-39566579 AGGGACAAGAAGAAGCAGGAGGG - Intronic
1179303669 21:40135626-40135648 AAGAAAAACAATGAGCAGGAAGG - Intronic
1179626734 21:42653461-42653483 GGGAAGAAGAAAGAGGGGGAAGG + Intergenic
1179646795 21:42781231-42781253 AGGAACCAGAATTAAGAGGAGGG - Intergenic
1179863621 21:44204368-44204390 TGGCAGATGAATGAGGAGGAGGG - Intergenic
1180121808 21:45756689-45756711 AGGAACAGAAAGGAGGAAGAAGG - Intronic
1180765473 22:18343819-18343841 GGGCAGAAGAATGAGGAGGCTGG - Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181087970 22:20451981-20452003 AGGAACAACAACCAGGACGAGGG - Intronic
1181157703 22:20934599-20934621 GGGAACAAGAAAGAGCAAGAAGG - Intronic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1182016348 22:27043326-27043348 AGGAAGAAGAGTGGGGAGGCTGG - Intergenic
1182129974 22:27843707-27843729 AGGATGAAGGATGAAGAGGAGGG + Intergenic
1182300265 22:29333224-29333246 AGGAAGAAGAATCATCAGGAGGG + Intronic
1182469148 22:30536691-30536713 TTGAACAAGGAGGAGGAGGAGGG + Intronic
1182679871 22:32070285-32070307 AAGAAGAAGAATGAAGAAGAAGG - Intronic
1182996110 22:34813862-34813884 CGGCAAAAGAATGAGGATGAGGG + Intergenic
1184244993 22:43231341-43231363 GGGAACAAGGATAATGAGGAGGG - Intronic
1184272007 22:43389688-43389710 AGGAGGGAGAAGGAGGAGGAGGG - Intergenic
1184345971 22:43913229-43913251 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1184412308 22:44332256-44332278 AGGAAGGAAAATGAGGAGGAAGG - Intergenic
1184449772 22:44576007-44576029 AGGAAGGAGGAAGAGGAGGAGGG + Intergenic
1184736665 22:46402190-46402212 AGAAACTAGAATGGGGATGATGG - Intronic
1184742704 22:46438296-46438318 AGAAACTAGAAAGAGGAGAAGGG + Intronic
1184952452 22:47853625-47853647 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1184952454 22:47853645-47853667 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1184989903 22:48160292-48160314 AGAAAGAAGAAGGAGGAGGAGGG + Intergenic
949190624 3:1244549-1244571 AGGAACAAAGAGCAGGAGGACGG + Intronic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949597726 3:5565510-5565532 AGGAAGAGGAATCAGGGGGAGGG - Intergenic
949614667 3:5739734-5739756 AGGAACAAGGAAGAGGGGAAAGG - Intergenic
949627372 3:5882053-5882075 AGGAAAGAGAAGGAGGAAGATGG - Intergenic
949709674 3:6860186-6860208 AGGAAGAAGAAAGAGGGGGCAGG - Intronic
950006798 3:9696757-9696779 AGAAACAGGAATGAAGAGCAGGG - Intronic
950023463 3:9805360-9805382 AGGAACCAGAATGTGGAGCTGGG + Intronic
950055067 3:10017767-10017789 AGGACCCTGAGTGAGGAGGAGGG - Intergenic
950114979 3:10444873-10444895 AGGAAGAAGAAAGAAGAGGCAGG - Intronic
950240672 3:11367265-11367287 AGGAGCCAGGAAGAGGAGGAGGG - Intronic
950727240 3:14924347-14924369 AGAGAAAAGAAAGAGGAGGAGGG - Intronic
951033822 3:17911101-17911123 AGGAAGAAGCAAGAGGAAGAAGG - Intronic
951930043 3:27955512-27955534 AGGAAGAGGAAGGAAGAGGAAGG - Intergenic
951930075 3:27955643-27955665 AGGAAGAGGAAGGAAGAGGAAGG - Intergenic
951964993 3:28372048-28372070 AGGAGGAAGAAGGAGGAGGAGGG - Intronic
952241201 3:31532886-31532908 AGGAGGAAGAAAAAGGAGGAGGG - Exonic
952256418 3:31699376-31699398 AGGAACCACAGTGAGGTGGAGGG - Intronic
952710214 3:36423867-36423889 AAGAAGAAAGATGAGGAGGAAGG - Intronic
952917063 3:38254623-38254645 AGGAACAAGGATGGGGAGGTAGG + Exonic
953182294 3:40607215-40607237 AGGACCCAGCAGGAGGAGGAAGG - Intergenic
953592211 3:44269348-44269370 AGGGAGGAGAAGGAGGAGGAGGG - Intronic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
953843111 3:46405861-46405883 AAAAAGAAGAAGGAGGAGGAGGG - Intergenic
953895734 3:46798692-46798714 CAGAACAAAAATGTGGAGGAAGG + Intronic
954003379 3:47575093-47575115 ACGAACAAGAACAAGAAGGATGG + Intronic
954680221 3:52341798-52341820 TGGAACAAAACTGAGGAAGAAGG + Intronic
954876479 3:53806005-53806027 GGGAACATGAGGGAGGAGGAGGG - Intronic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
955006845 3:54976597-54976619 AAGAAGAAGAATAAGGAGGATGG - Intronic
955045854 3:55358988-55359010 AGGAAAAAGAAAGAGAAGAAGGG + Intergenic
955114252 3:55981588-55981610 AGGAAGAAGAGGAAGGAGGAGGG + Intronic
955136869 3:56227604-56227626 AGGCACAAGAAAGAGTAGGGTGG - Intronic
955307451 3:57848552-57848574 AGGAAGAAAAAGGAGAAGGAGGG - Intronic
955600584 3:60641341-60641363 AGGTACAAGGATGAGGCAGAGGG + Intronic
955679221 3:61482954-61482976 AGGAACTGGAGGGAGGAGGAAGG - Intergenic
955746449 3:62145373-62145395 AGTAACAATAATGATGATGATGG - Intronic
955867603 3:63401504-63401526 AGGACAAAGAATGAGAAGGTAGG + Intronic
956000766 3:64727891-64727913 AGGAAAAAGAATATGGAGGTGGG - Intergenic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956382908 3:68685122-68685144 AGAAAAAAGAATGAAAAGGAAGG - Intergenic
956914600 3:73857998-73858020 AGGAAAAAGAAGGAGGACAAAGG + Intergenic
957269714 3:78013690-78013712 AGGAACAACAATGAGGCAGCAGG - Intergenic
957582535 3:82092961-82092983 AAGTACTAGAAGGAGGAGGAAGG - Intergenic
957595778 3:82263800-82263822 GGGGACTAGAAGGAGGAGGAGGG + Intergenic
958028895 3:88083051-88083073 AGGAAGAAGAGGGAGGAAGAGGG - Intronic
958262559 3:91398644-91398666 AGGAAAGATAATGAGGGGGAAGG + Intergenic
959034672 3:101346992-101347014 AGGAGGAAGAAAGAGGAGGAAGG + Intronic
959089220 3:101884642-101884664 AGGAAGAAGGATGGAGAGGAAGG + Intergenic
959411303 3:106025951-106025973 ATGAAAAAGAAAGAGAAGGAAGG + Intergenic
959481516 3:106878448-106878470 AGGAAGAAGAAGAGGGAGGAAGG - Intergenic
960173966 3:114495725-114495747 AGGAAAAGAAATGAGGAGGAAGG + Intronic
960418603 3:117415600-117415622 GGGAAGAAGAAGGGGGAGGAAGG - Intergenic
960496562 3:118382740-118382762 AGGAAGAAAGATGAGAAGGAGGG + Intergenic
960585232 3:119314992-119315014 AGGCACAAGGGTGTGGAGGAGGG - Intronic
960674793 3:120183483-120183505 AGGAAAAAGAAGGAAAAGGATGG - Intronic
960812149 3:121635675-121635697 AAGAAAAAGAATGAGGGAGAAGG + Intronic
960849113 3:122033918-122033940 AAGAAGAAAAATGAGGTGGAAGG - Intergenic
960910033 3:122640407-122640429 AGGAATAAGAAGGAGAAGAATGG - Intergenic
961007853 3:123416748-123416770 AGGAAGAGGAATGAGGAGAGAGG + Intronic
961100810 3:124197500-124197522 AGGATCAAGGCTGAGGATGAAGG - Intronic
961573026 3:127813944-127813966 GGGAAAAATAAGGAGGAGGAAGG - Intronic
962076804 3:132090717-132090739 AGGAGGAAGAGAGAGGAGGAAGG + Intronic
962247458 3:133808004-133808026 AGGTACAACAATGCAGAGGAGGG - Intronic
962511055 3:136101041-136101063 AGAAACAAGAATTAGGAGAAAGG + Intronic
962865938 3:139448083-139448105 AGGAAGAAGAGAAAGGAGGAAGG - Intergenic
962883896 3:139605209-139605231 ATGAATAAGGATGAGGAGGAAGG - Intronic
963027155 3:140931269-140931291 AGAAACACGAATGAGGGGGAAGG + Intergenic
963069505 3:141291445-141291467 AGGTACAAAAATGAGGTGGATGG - Intronic
963534967 3:146516048-146516070 AGGAACAAAAATCAGGAGTGTGG - Exonic
963932970 3:151023453-151023475 AGGAAGGAGAAAGAGGAGAAAGG + Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964564344 3:158033209-158033231 AAGAAGGAGAAGGAGGAGGAGGG + Intergenic
964686634 3:159403177-159403199 AGAAGCAAAAATGAGGAGGGTGG + Intronic
964737253 3:159929586-159929608 AGGAAGAAGTGTGAGGAGGGAGG + Intergenic
965594873 3:170400692-170400714 AGGAAGAAGAAAGAGAAGGAAGG - Intergenic
965622262 3:170653778-170653800 AAGAAGAAGAAGGAGGAGAAGGG - Intronic
965711734 3:171562693-171562715 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
965711735 3:171562703-171562725 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
966957480 3:184897909-184897931 AGAAGCAAGAGTGAGGATGAAGG - Intronic
966963289 3:184963109-184963131 AAGAAAAAGAATAAGGAGGGAGG - Intronic
966981357 3:185139138-185139160 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
967258602 3:187619405-187619427 AGAGACAAGGCTGAGGAGGAGGG - Intergenic
967368564 3:188716420-188716442 AAAAAAAACAATGAGGAGGATGG + Intronic
967782158 3:193451384-193451406 AGGCACAATAATCAGGAGGCTGG + Intronic
967836486 3:193968590-193968612 TGGAGCAAGAGAGAGGAGGAGGG + Intergenic
967953541 3:194859451-194859473 AGGAAAAAGACAGAGGAGGCAGG + Intergenic
967987683 3:195107507-195107529 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
967987687 3:195107517-195107539 AGGAGGAGGAAGGAGGAGGAGGG + Intronic
968359965 3:198139827-198139849 AGGACAATGGATGAGGAGGAGGG + Intergenic
968669522 4:1841531-1841553 AAGAACAAGAAGCTGGAGGAAGG - Exonic
968789675 4:2650901-2650923 ACTAACAAGACTGTGGAGGAGGG - Intronic
968855919 4:3121939-3121961 AGAGAAAAGAATCAGGAGGAGGG - Intronic
968973394 4:3808608-3808630 AGGAAGAAGAATGAGTGGGCAGG + Intergenic
969082418 4:4629146-4629168 GGGAGCAAGAAAGAGGAGGTGGG - Intergenic
969233889 4:5851694-5851716 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
969354741 4:6618847-6618869 AGGATCATGAAAGAGGAGGTGGG - Intronic
969365040 4:6689499-6689521 AGGAAACTGAAGGAGGAGGAGGG - Intergenic
969407283 4:7001952-7001974 AGGCCCAAGAAAGAGCAGGAAGG - Intronic
969511386 4:7620017-7620039 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969511391 4:7620033-7620055 AGGAAGGAGGAGGAGGAGGAAGG - Intronic
969779292 4:9384808-9384830 AGGAACCAGAAGGGGGAGGCAGG - Intronic
969838137 4:9860165-9860187 AGGGAGGAGAAGGAGGAGGAAGG - Intronic
970162080 4:13199026-13199048 GAGAACAAGGATGAAGAGGAAGG + Intergenic
970219693 4:13797979-13798001 AGAAGAAAGAAGGAGGAGGAGGG + Intergenic
970444209 4:16110295-16110317 AGGAGGAGGAAGGAGGAGGAAGG + Intergenic
970642670 4:18084724-18084746 CTGAACAAGAATGTGGAGGTGGG + Intergenic
970869495 4:20799157-20799179 AGCAACTAGAATGGGCAGGATGG - Intronic
971146002 4:23976972-23976994 AGGAAGAAGGAGGAGGAAGAGGG + Intergenic
971336714 4:25729944-25729966 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
971380787 4:26095654-26095676 AGGAAGAAGAAGGAGGAGGAAGG + Intergenic
971439173 4:26661320-26661342 AGGAAAAAGAAGGTGGAGGGTGG - Intronic
971633851 4:29031456-29031478 AGGGAAAAGGAGGAGGAGGAGGG - Intergenic
971756745 4:30717560-30717582 AGGAATGAGAGTGAGGAGGGCGG + Intergenic
971823018 4:31584206-31584228 AGCAAAAAGAGTGAGGTGGAAGG - Intergenic
971849131 4:31960529-31960551 AGGTTCAAGCATGAGAAGGAAGG - Intergenic
971980172 4:33741632-33741654 AGGCACTAGAATTAGGAGAAAGG + Intergenic
972390365 4:38607646-38607668 AGGAACATGAGTGAAGAGGTAGG - Intergenic
973156377 4:46959249-46959271 GGGATCTAGAATCAGGAGGATGG + Intronic
973555439 4:52077179-52077201 AGGAGGAAGAAAGAGAAGGAAGG - Intronic
973628448 4:52795507-52795529 AGGAAGAAGAAGAAGAAGGAAGG + Intergenic
973803289 4:54499422-54499444 ATTAACTAGAAGGAGGAGGAGGG - Intergenic
974012899 4:56623711-56623733 AAGAGAAAAAATGAGGAGGAAGG - Intergenic
974458288 4:62156503-62156525 AGTTACAGGAATGAAGAGGAAGG - Intergenic
974999981 4:69212011-69212033 AGGTAAAAGAATGAAGGGGAGGG - Intronic
975260770 4:72295470-72295492 AGGAACAAGAATGTGGTGAAAGG + Intronic
975424822 4:74213901-74213923 AGAAAAAAGAATGAAAAGGAAGG - Intronic
975708393 4:77134111-77134133 AGGATGAAGAAAGAGAAGGAGGG + Intergenic
975783332 4:77862550-77862572 AAGAAAAAGAATAAGAAGGAAGG + Exonic
975795239 4:78000148-78000170 GAGAAGAAGAATGAAGAGGAGGG + Intergenic
975947082 4:79720059-79720081 ATGGAAAAGCATGAGGAGGAAGG - Intergenic
976001706 4:80381871-80381893 AGGAAAAAGGAACAGGAGGAAGG - Intronic
976201470 4:82583557-82583579 AGGAACAATATTAATGAGGAAGG - Intergenic
976561967 4:86511893-86511915 AAGGAGAAGAATGAGGAGGAAGG + Intronic
977189747 4:93984875-93984897 AAGAAAAAGAAAGAGAAGGAAGG + Intergenic
977402210 4:96547033-96547055 AGGAGAAAGAATGAGGAAGCAGG + Intergenic
977820112 4:101461395-101461417 AGGAGTAGGAATGAGGAGAATGG + Intronic
977927324 4:102716011-102716033 ATTAAAAAGAATGAGGAGGCCGG + Intronic
978235815 4:106458543-106458565 AGGAAGAAGAAGGAGGAAGAAGG + Intergenic
978264777 4:106810417-106810439 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
978566666 4:110089855-110089877 AAGGAAAAGAAAGAGGAGGAAGG + Intronic
978908925 4:114043124-114043146 AGGAAGAAGAATGAGCAAAAGGG + Intergenic
979155913 4:117390952-117390974 AGGAAAAAAATTGAGGAGAAAGG + Intergenic
979168827 4:117573163-117573185 AGGAGAAAGAATTAGCAGGAAGG + Intergenic
979268061 4:118726309-118726331 AGAAAGAAGAATCAGGAGCAGGG + Intronic
979550184 4:121981957-121981979 CGGGACAAGAATGATGATGAAGG - Intergenic
980190694 4:129520552-129520574 AAGAAGAAGAAGGAGGAAGAGGG + Intergenic
980225152 4:129974041-129974063 TAGAACAAAAAGGAGGAGGAAGG - Intergenic
980341563 4:131555086-131555108 GGGAGCAAGAATGAGGACCAGGG + Intergenic
980568896 4:134584148-134584170 AGGAAGGAGAATGATGAAGAGGG - Intergenic
980876592 4:138667893-138667915 AGGAACAAGAGAGAGGAGGCAGG - Intergenic
981011100 4:139925922-139925944 TGCAAGAAGAAAGAGGAGGACGG + Intronic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981837616 4:149073546-149073568 AGGGAGAAGAATGAGAAAGACGG - Intergenic
982068890 4:151677931-151677953 AGGAAGAAGGAGGAGGAGGGAGG - Intronic
982125178 4:152178043-152178065 AGTAATAAGGAGGAGGAGGAAGG + Intergenic
982344248 4:154339243-154339265 AAGAACAAAAAGGTGGAGGAAGG - Intronic
982587491 4:157260813-157260835 AGAAGGAAGAAAGAGGAGGAGGG - Intronic
982612321 4:157591084-157591106 TGGAACAAGAAGAAGGAGTATGG + Intergenic
982733562 4:158981153-158981175 AGAAAAAAGAATGAAAAGGAAGG + Intronic
982870374 4:160572655-160572677 AAGCCCAAGAAAGAGGAGGAAGG + Intergenic
982941228 4:161559327-161559349 AGAAAGAACAAGGAGGAGGATGG - Intronic
983263811 4:165486520-165486542 AGGAACCAAAATGGGGAGGCAGG - Intronic
983647666 4:170008221-170008243 GGGAATAAAAATGAGGAAGAGGG - Intronic
983928940 4:173432422-173432444 AGGAAGAAGGAGGAGAAGGAAGG - Intergenic
984019496 4:174467866-174467888 AGGTAGGAGAGTGAGGAGGATGG - Intergenic
984168673 4:176334281-176334303 AGGAACAACTATGTGGTGGATGG + Intergenic
984374589 4:178911419-178911441 AAGAAGAGGAATGAGGAGAACGG + Intergenic
984736573 4:183114186-183114208 AGGAACAAGAGAGAGGATGGCGG - Intronic
985143110 4:186863375-186863397 AGGACCAAGAAGGAAGAGAAGGG - Intergenic
985248940 4:188003711-188003733 ACGAACAAGAATGAACAAGAGGG + Exonic
985707850 5:1411650-1411672 AGAAACAAGGAGGAGCAGGAGGG + Intronic
985957986 5:3278805-3278827 AAGAAGGAGAAGGAGGAGGAAGG - Intergenic
986030248 5:3886586-3886608 AGAAATAAGAATGAGGTGGGAGG - Intergenic
986384423 5:7217752-7217774 AGCAACAAAAATGGTGAGGAAGG - Intergenic
986507910 5:8471788-8471810 AGGAACGAGAATGCTGAGCAAGG + Intergenic
986536397 5:8792575-8792597 AGGAGCAAGAGAGAGGAGGGAGG - Intergenic
986595483 5:9417572-9417594 AGGAACAAGAATGATCATGAAGG + Intronic
986764837 5:10915950-10915972 AGTGACAAGACTGGGGAGGAAGG - Intergenic
986899698 5:12416297-12416319 AGGAATAGGAAGGAGGAGGCTGG + Intergenic
987032960 5:13992369-13992391 AGACATAAGAATGAGAAGGAAGG + Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987228902 5:15871740-15871762 AGAAAAAAGAATGAAAAGGAAGG + Intronic
987675950 5:21072929-21072951 AGGAAGAAGAAAGAAGACGAAGG - Intergenic
987731250 5:21775407-21775429 AGGAGATAGAATGAGAAGGAGGG + Intronic
987896613 5:23954155-23954177 AGGAAGAGGAATGTTGAGGAAGG + Intronic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988163139 5:27547298-27547320 AGGAACATGAATGAAGATGAAGG - Intergenic
988222805 5:28370953-28370975 AAGAAGAAGAAGGAGGAGGAGGG - Intergenic
988222818 5:28370999-28371021 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
988348919 5:30075257-30075279 ACAAAAAAAAATGAGGAGGAGGG + Intergenic
988453100 5:31362867-31362889 AGGAAGTGGAGTGAGGAGGAAGG - Intergenic
988680664 5:33481100-33481122 AGGAAGAGGAATGAAGGGGAGGG - Intergenic
988680721 5:33481260-33481282 AGGAAGGAGAATGAAGGGGAGGG - Intergenic
988737832 5:34040404-34040426 AGGGAAAAGAAAGAAGAGGAAGG + Intronic
988914656 5:35880402-35880424 AAGAACAAGAAAAAGTAGGAAGG - Intergenic
990102187 5:52204663-52204685 AGGAACAAGAATCAGGGGTTTGG - Intergenic
990119046 5:52426089-52426111 AGCAACAAAAAGGAAGAGGAAGG + Intergenic
990211042 5:53481534-53481556 AGAAAGAAGAATGAGGCAGAGGG - Intronic
990300623 5:54445989-54446011 TAGAACAAAAAGGAGGAGGAAGG + Intergenic
990569687 5:57065714-57065736 AGGAAAGAAAAGGAGGAGGAGGG - Intergenic
990681522 5:58249897-58249919 AGGAAGAAGGAAGAGGAGAAGGG + Intergenic
991564026 5:67985887-67985909 AGGAACAAGAAGCAGAAGCAAGG - Intergenic
991922124 5:71667414-71667436 AGAAAAAAGAAAGAGAAGGAAGG - Intergenic
992030207 5:72713513-72713535 TTGAACAAAAAGGAGGAGGAAGG + Intergenic
992090528 5:73312274-73312296 AGGCATAAAAATGAGGAGCAAGG - Intergenic
992097393 5:73375665-73375687 AAGAACAAGCAGGAAGAGGAAGG + Intergenic
992530786 5:77649950-77649972 AGGAACAAGATAGAAGAGGCGGG - Intergenic
992556894 5:77912843-77912865 AGGAATGTGAAGGAGGAGGAGGG - Intergenic
993100855 5:83538170-83538192 AAGAAAAGGAAGGAGGAGGAGGG + Exonic
993168235 5:84384061-84384083 AGATACAGGAAAGAGGAGGACGG - Intronic
993407952 5:87535508-87535530 AAGAAAGAGAAAGAGGAGGAAGG - Intergenic
993558490 5:89372672-89372694 AAGAAGGAGAAGGAGGAGGAGGG - Intergenic
993561251 5:89413003-89413025 AGGAAGAAGAAATAGGAGAAAGG - Intergenic
993577322 5:89618937-89618959 AGGAACAAGAGAGAGAAAGAAGG + Intergenic
993590374 5:89788095-89788117 TAGAACAAAAATGTGGAGGAAGG + Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995148373 5:108811860-108811882 TGGAACAAAAAGGAGGAGGAAGG - Intronic
995907438 5:117142498-117142520 AGGAAGAAGAAGGAGGGGGAGGG - Intergenic
997206771 5:132054778-132054800 AGGAAGAAGGATGAGGAGGAGGG + Intergenic
997739906 5:136244193-136244215 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
997898283 5:137739903-137739925 AGGCAAGAGAGTGAGGAGGAAGG - Intergenic
997995068 5:138578543-138578565 AGGAAGAAAAATGAGAAGGCAGG + Intergenic
998034909 5:138906991-138907013 AGAAAGAAGGAGGAGGAGGAAGG - Intronic
998410465 5:141906712-141906734 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
998533925 5:142911404-142911426 AGGAAATAAAATAAGGAGGAGGG - Intronic
998627825 5:143865473-143865495 TGGCAGAAAAATGAGGAGGAAGG + Intergenic
999039453 5:148390882-148390904 AGGAAGAAAAAGGAGGAAGAAGG + Intronic
999171417 5:149598439-149598461 AGGAAGAAGAAAGAAGAGGAAGG - Intronic
999232950 5:150072984-150073006 AGGAAAATGAATGAGGCTGAGGG + Intronic
999281252 5:150367641-150367663 AGGAGCAAGAGAGAAGAGGATGG - Intronic
999643421 5:153694961-153694983 ATGAACAAGAAGGAGGAGAAAGG + Intronic
1000078968 5:157826058-157826080 AGGAAGAAGGGAGAGGAGGAAGG + Intronic
1000106700 5:158066749-158066771 AGGAACAAGAGAGAGAAGGGGGG + Intergenic
1000138139 5:158373791-158373813 AGGAACTAGTTTGGGGAGGAAGG + Intergenic
1000946167 5:167426031-167426053 AGTAACAAAAATGAGGAGGGTGG - Intronic
1000968268 5:167685425-167685447 AGGAAAAAGAAGGCCGAGGAAGG - Intronic
1000994574 5:167945924-167945946 AGAAACAAGAAGGGGGATGAAGG - Intronic
1001108406 5:168875303-168875325 AGAAAGAAGAAAGAGGAGGAAGG + Intronic
1001132903 5:169079536-169079558 AGGAGGAAGAAGGAGGAAGAAGG + Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001135512 5:169099406-169099428 AGGAACAGGAGCTAGGAGGAAGG - Intronic
1001203172 5:169737795-169737817 AGATACAGGAATGGGGAGGAAGG - Intronic
1001511093 5:172322455-172322477 AGAAAGAAGAAGGAAGAGGAGGG - Intergenic
1001514324 5:172344906-172344928 GGGAAAAGGAAGGAGGAGGATGG + Intronic
1001744363 5:174079665-174079687 AGCAACACAAATCAGGAGGAAGG - Intronic
1002004967 5:176225013-176225035 AGGCAAAGGAATGAGAAGGAAGG + Intergenic
1002288981 5:178187076-178187098 AGGGAGGAGCATGAGGAGGAGGG - Intergenic
1002309249 5:178304728-178304750 TGGAAAAACAATGAGGGGGAGGG + Intronic
1002392952 5:178930011-178930033 AAGAGCAAGAGTGAGGAGGGAGG + Intronic
1002438272 5:179247349-179247371 AGGAAAAAGAATGAGGAAAAAGG + Intronic
1002557078 5:180050627-180050649 AGGATGTAGAATAAGGAGGAGGG - Intronic
1002678653 5:180941067-180941089 AGCAAGAAGAAAGAGGTGGAAGG + Intronic
1002969131 6:1996122-1996144 AGGAAGAAGAGGAAGGAGGAAGG - Intronic
1003288420 6:4755987-4756009 AGGAGAAATAATAAGGAGGAGGG - Intronic
1003291698 6:4784943-4784965 AGGAAGGTGAATGAGGAGCAAGG - Intronic
1003552652 6:7112738-7112760 AGGTAAAAGAATGAGGAAGGTGG + Intronic
1003658633 6:8039283-8039305 AGGAAGTATAGTGAGGAGGAGGG + Intronic
1003665632 6:8108863-8108885 AGGGAGGAGAATGAGGACGATGG - Intergenic
1004001481 6:11600812-11600834 AGGAAGAAGAATGGGAAGAAGGG - Intergenic
1004266453 6:14152085-14152107 AGGAAGAAGGAAGAGGAAGAAGG - Intergenic
1004387561 6:15185680-15185702 AGGAAAAAGAAAGGGAAGGAAGG + Intergenic
1004821276 6:19370713-19370735 AGGAACAAAATGGAGGGGGATGG + Intergenic
1004992920 6:21159384-21159406 AGGAACAAGAATGGGTATGGAGG - Intronic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005040749 6:21597354-21597376 AGGAAAAAGAAATACGAGGATGG - Exonic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005379125 6:25216087-25216109 AGGCACAAGAATGAGCCTGAGGG - Intergenic
1006110065 6:31739018-31739040 AGGAACAAAGCTGGGGAGGATGG + Intronic
1006205840 6:32342000-32342022 TGTGACAGGAATGAGGAGGAGGG - Intronic
1006252985 6:32806357-32806379 AGAAAAAAGAATGAAAAGGAAGG - Intergenic
1006294010 6:33161797-33161819 AGGAAGAAGTACGGGGAGGAGGG + Intergenic
1006868318 6:37227365-37227387 GGGAAAAAGAATGGGAAGGAAGG - Intronic
1007171022 6:39863608-39863630 AGGAACAGGAATGAGCAGGATGG + Intronic
1007271424 6:40640439-40640461 GGGAGAAAGAATGAGAAGGAGGG - Intergenic
1007444367 6:41894379-41894401 AGGAATAAGAGTGTGGTGGAAGG - Intronic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1007714513 6:43848023-43848045 AGAATGAAGAAGGAGGAGGAAGG + Intergenic
1007828922 6:44623225-44623247 AGAAAGAAGAAAAAGGAGGAAGG - Intergenic
1008871644 6:56279173-56279195 AAGAACAAGAGTGAGGTGGGAGG - Intronic
1008915862 6:56785866-56785888 AAGATCAAGAATAAGGAAGAGGG - Intronic
1008992858 6:57624233-57624255 AGGAAAGATAATGAGGGGGAAGG - Intronic
1009181476 6:60523339-60523361 AGGAAAGATAATGAGGGGGAAGG - Intergenic
1009224561 6:61010331-61010353 AGGAACAACAACGAGGGGGCGGG + Intergenic
1009550037 6:65078899-65078921 AGGAACAAGAGGGAGTGGGAGGG - Intronic
1009803984 6:68578702-68578724 AGGAAAAAGAAAAAGAAGGAAGG + Intergenic
1010351166 6:74876289-74876311 AAGAAGAACAAGGAGGAGGAAGG + Intergenic
1010933686 6:81834959-81834981 AGGAAGAAGAATGAGGGAGGAGG + Intergenic
1011074636 6:83425501-83425523 AGGAAAAAGAATGAGCAAAAGGG + Intronic
1011085573 6:83536918-83536940 AGGAAAAAGAAAGAAAAGGAAGG - Intergenic
1011165622 6:84442715-84442737 ATGAACAGGAATTAGGAGGAGGG + Intergenic
1011504792 6:88029518-88029540 AGGAGCAAGAAGGAGTGGGAGGG + Intergenic
1011539527 6:88415418-88415440 AGGCACTAGAATTAGGAGAAGGG - Intergenic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1011902679 6:92319670-92319692 AGGAAAAAGAGCCAGGAGGAAGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1013246198 6:108289723-108289745 AGGAACAAGAGTATTGAGGAAGG + Intergenic
1013732911 6:113190165-113190187 AGGAAGAAGGCTGAGGAAGATGG - Intergenic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1014054413 6:116997174-116997196 TGGAACAAAAAGGTGGAGGAAGG + Intergenic
1014207566 6:118672779-118672801 AGAAAGAAGAAGGAGGAGGAAGG + Intronic
1014207569 6:118672789-118672811 AGGAGGAGGAAGGAGGAGGAAGG + Intronic
1014232577 6:118920659-118920681 AGGAGCAAGAGTGGGGAGGGAGG - Intronic
1014365005 6:120528902-120528924 AGGAACTAGAAGGAGGAGCAGGG - Intergenic
1014757200 6:125314485-125314507 AGGAAAAAGGAAGAGGAAGAGGG + Intergenic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1014999773 6:128200827-128200849 AAGAAGAAGGATGAGGAGGAGGG + Intronic
1015792663 6:136979746-136979768 AGGAAGAAAAATCAAGAGGAGGG - Intergenic
1015802221 6:137071582-137071604 AGAAAAAAGAATGAACAGGAAGG + Intergenic
1015812700 6:137177326-137177348 AGGAACATGGATGTGGAAGAAGG - Intergenic
1015847563 6:137536701-137536723 AAAAACAAGGATGAAGAGGAAGG - Intergenic
1016402365 6:143694206-143694228 AGGAAGAAGTAGAAGGAGGAAGG + Intronic
1016505514 6:144774427-144774449 AGGAAGATAAATGAAGAGGATGG + Intronic
1016714748 6:147211877-147211899 ATGAACAAAAATGATGGGGAGGG - Intronic
1016785350 6:148005496-148005518 AGGGAAAGGAAAGAGGAGGAGGG + Intergenic
1016817272 6:148314686-148314708 AGGGACAAGAACGAGAAGGTGGG + Intronic
1016824321 6:148374282-148374304 AGGAATATGAATGGGAAGGAGGG + Intronic
1016848799 6:148595347-148595369 AGGAATGACAATGAGGATGATGG - Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1017462952 6:154668337-154668359 AGGAAGAAAAAGAAGGAGGAGGG + Intergenic
1017770101 6:157638298-157638320 AGGAAGGAGTAGGAGGAGGACGG - Intronic
1018038076 6:159898655-159898677 AGGAAGAGGAAGGAGGAGGGAGG - Intergenic
1018044766 6:159956085-159956107 AGGAAGAAAAGAGAGGAGGAAGG + Intergenic
1018177442 6:161189383-161189405 AGGAGCAGGGAAGAGGAGGAAGG + Intronic
1018377518 6:163227266-163227288 AGGAACAAGAGGGAGGTGGGAGG + Intronic
1019070851 6:169343550-169343572 AGGAACCAAAAAGAGGAGGCAGG - Intergenic
1019091846 6:169543046-169543068 TGTAAGAAGAATGAGAAGGAAGG + Intronic
1019260024 7:76794-76816 AGGACAATGGATGAGGAGGAGGG - Intergenic
1019395090 7:813832-813854 AGGAACAAGAACAAGCAGGTAGG - Intergenic
1019484066 7:1280423-1280445 AGGAAGAAGAAGAAGGAAGAAGG + Intergenic
1019484085 7:1280526-1280548 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1019484089 7:1280546-1280568 AGGAAGAAGAAGGAGGAAGGAGG + Intergenic
1019484142 7:1280826-1280848 AGGAAGAAGAAGGAGGAAGGAGG + Intergenic
1019484171 7:1280979-1281001 AGGAAGAAGAAGGAGGAAGGAGG + Intergenic
1019520302 7:1457881-1457903 AGGACCCGGAATGGGGAGGAAGG - Intronic
1020019949 7:4859581-4859603 AGGAAGGAGAATGAGGGGTACGG - Exonic
1020259938 7:6525675-6525697 AGGAACAAGAAGGAGCAAGCAGG + Intronic
1020594758 7:10191946-10191968 TGAAACAAGAGTGAGTAGGAAGG - Intergenic
1020906017 7:14065658-14065680 AAAAAAAAGAATGAGGAGGAAGG - Intergenic
1021205874 7:17780247-17780269 CTGAACAAGAATGATGAGAATGG - Intergenic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021659425 7:22905034-22905056 GGGAACAAGAGAGAGAAGGAGGG + Intergenic
1021789889 7:24194282-24194304 AGGAGCAAGAGGGAGGAGGAGGG + Intergenic
1021828680 7:24580540-24580562 AGAAACAAGAAGGCAGAGGAGGG - Intronic
1022008241 7:26286823-26286845 ACTAACAAGAATAAGGAGGTGGG + Intergenic
1022037814 7:26550591-26550613 AGGAGGAAGAAGAAGGAGGAAGG + Intergenic
1022037815 7:26550594-26550616 AGGAAGAAGAAGGAGGAAGGAGG + Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022697815 7:32727993-32728015 AGGACGAAGAATGAGAGGGAGGG - Intergenic
1022756728 7:33300749-33300771 AGGAAGAACATTAAGGAGGAAGG - Intronic
1022828956 7:34045509-34045531 AGGGTCAAGAATGAGAATGAGGG + Intronic
1022846623 7:34216333-34216355 TAGAACAAGAAGGTGGAGGAGGG - Intergenic
1022921425 7:35019500-35019522 AGGAAAAAGAAAGAAGAAGAAGG + Intronic
1023227731 7:37988945-37988967 TAGAACAAGAAGGTGGAGGAAGG - Intronic
1023581618 7:41690131-41690153 AAGAAGAAGAAAGAAGAGGAGGG - Exonic
1023991549 7:45131902-45131924 AGGGACAAGAAACAGGAGGGAGG - Intergenic
1024465376 7:49706625-49706647 TGTAACAGGAATGTGGAGGATGG - Intergenic
1024721000 7:52137360-52137382 AAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1024781503 7:52855921-52855943 AGGAGCAAGTATGAGGAATAGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025828514 7:65030445-65030467 AAGAGGAAGAAGGAGGAGGAGGG + Intergenic
1025887791 7:65614601-65614623 AGGAAGAAGGAGGAAGAGGAAGG - Intergenic
1026150421 7:67783642-67783664 TGGGACCTGAATGAGGAGGATGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026205617 7:68255040-68255062 AAGAAGAGGAAGGAGGAGGAGGG - Intergenic
1026474905 7:70726897-70726919 AGGAAAGAGAATGAGGAAGGGGG - Intronic
1026508455 7:71006950-71006972 AATAAGAAGAAAGAGGAGGAAGG - Intergenic
1026679026 7:72451322-72451344 AGGAGAAAGAAAGAGGAGGAGGG + Intergenic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1027515020 7:79130989-79131011 AGGAACAGGGATGAGGATCATGG + Intronic
1027645317 7:80790324-80790346 AGGAGAAAGGAGGAGGAGGAAGG + Intronic
1028041682 7:86061562-86061584 AGAAACAAAATTGTGGAGGATGG + Intergenic
1028090222 7:86691258-86691280 CGGAAGACAAATGAGGAGGATGG - Intronic
1028108594 7:86911035-86911057 AGAAACAAGAATAAAAAGGAAGG + Intronic
1028128438 7:87142662-87142684 AGGTACAAGAATGTGCAGGAGGG - Intergenic
1028213016 7:88098661-88098683 AGGAATAAAAGTGATGAGGAAGG - Intronic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028329657 7:89573733-89573755 AGAAAAATGAAAGAGGAGGAGGG + Intergenic
1028382275 7:90212251-90212273 AGGAACCAAGAGGAGGAGGAGGG - Intronic
1028579340 7:92389429-92389451 GGGAGGAAGAATGAGGAAGATGG - Intronic
1028648412 7:93122789-93122811 AGAAAAAAGAATGAAAAGGAAGG + Intergenic
1029013646 7:97290568-97290590 AGGAAGAAGAAGGGGGAGGATGG + Intergenic
1029204914 7:98863834-98863856 AGGAAGAAGAAAGAAAAGGAAGG - Intronic
1029548070 7:101221830-101221852 AGGTCCAAGGAGGAGGAGGAAGG + Intronic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1030108750 7:106008821-106008843 AGGAACAAGGAAGAGCAGGAGGG - Intronic
1030583071 7:111384152-111384174 ATGAAGAAGAAGGAGGAGAAAGG + Intronic
1030638259 7:111974576-111974598 AGGAAAAGGGATGGGGAGGAGGG + Intronic
1030649835 7:112105655-112105677 AGGAAGTGGAATGACGAGGAAGG - Intronic
1030728291 7:112952913-112952935 AGGAACATGAATGAAGCTGAAGG - Intergenic
1031706997 7:124993585-124993607 AGGAAAAAGAATAGGGAGGGAGG + Intergenic
1031838614 7:126709476-126709498 AGGAAGAAGAAGAAGGAGGAGGG + Intronic
1031838615 7:126709479-126709501 AAGAAGAAGAAGGAGGAGGGAGG + Intronic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1031945479 7:127835200-127835222 AGGAACAAGAATATGAAGAAAGG - Intronic
1032378507 7:131449695-131449717 GGGAAAAAGAATGGGAAGGAGGG - Intronic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1032484643 7:132276277-132276299 AGGAGAGAGAATGAGAAGGAAGG - Intronic
1032503333 7:132416510-132416532 GGGATCAAGGATGAGGATGATGG - Intronic
1032523617 7:132563412-132563434 AGGAAGGAGAAGGAGGAGGAGGG - Intronic
1032799843 7:135309184-135309206 AGGAAGAAGAAGGAAGAGGAAGG + Intergenic
1032894474 7:136235490-136235512 AGGAGCAAGAAAGAGGAGGAGGG + Intergenic
1032908741 7:136404483-136404505 AGGAAAAAGGATGAGGAGGGAGG - Intergenic
1032937943 7:136755587-136755609 AGGCTCAAGAATAAGGAGAAGGG - Intergenic
1032987036 7:137349002-137349024 AAGAAAAAAAATGAGAAGGAGGG + Intergenic
1033155996 7:138957449-138957471 AAGAAGAAGAAGGAGAAGGAGGG - Intronic
1033832587 7:145271469-145271491 AGGAAGAAGAAAAAGAAGGAAGG + Intergenic
1033832604 7:145271580-145271602 AGAAGGAAGAAGGAGGAGGAGGG + Intergenic
1033863098 7:145653691-145653713 AGGAAAAAGAAGTAGGAGGAAGG - Intergenic
1034219901 7:149436068-149436090 AGGAGCAAGAGTGAGCAGCATGG + Intronic
1034285463 7:149880748-149880770 AGAAACAAGAATCAGGTGGGCGG - Intergenic
1034355305 7:150446409-150446431 AGGAAGAAGAATGAGTAGTGAGG + Intergenic
1034688209 7:152992621-152992643 AGGGGAAAGAATGAGCAGGAGGG - Intergenic
1034696465 7:153058555-153058577 AGGAGCAAGAAAGCGGAGAATGG - Intergenic
1034697602 7:153067786-153067808 AGGAACAAGAAAGGGGCAGATGG + Intergenic
1034841144 7:154398533-154398555 AGGAAAAAGAAATAGGATGATGG - Intronic
1034859339 7:154582536-154582558 AGGAAACAGGAGGAGGAGGAAGG - Intronic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035100185 7:156389826-156389848 AGGAAGAAGGCTGAGGGGGAGGG - Intergenic
1035241576 7:157534073-157534095 AGGAACGAGAGCCAGGAGGAAGG - Intergenic
1035242085 7:157538727-157538749 AGGACTGAGAATGGGGAGGAAGG + Intergenic
1035280696 7:157776357-157776379 AGGAAGAAGAGAGAGGAGGGAGG - Intronic
1035426899 7:158784051-158784073 AGGCACAGGGAGGAGGAGGAGGG + Intronic
1036029834 8:4956970-4956992 AGACACAAGAATCAGGAGCATGG - Intronic
1036057555 8:5274600-5274622 TGGAACAAAAATGATGAGGGGGG + Intergenic
1036237516 8:7053281-7053303 AGGAACCAGAATGGGGAGTGGGG - Intergenic
1036276728 8:7358770-7358792 AGGAACCAGAAGGGGGAGGCAGG - Intronic
1036344605 8:7951575-7951597 AGGAACCAGAAGGGGGAGGCAGG + Intronic
1036560956 8:9900090-9900112 AATAACAAGAATGAGAATGATGG - Intergenic
1036632757 8:10526671-10526693 AGGACCAAGAATGTGGGGGATGG + Intronic
1036644053 8:10601218-10601240 AGGAGAGAGAAGGAGGAGGAGGG + Intergenic
1036839946 8:12112342-12112364 AGGAACCAGAAGGGGGAGGCAGG + Intronic
1036861737 8:12358581-12358603 AGGAACCAGAAGGGGGAGGCAGG + Intergenic
1037086487 8:14857124-14857146 ATGAACAAGAGAGAGGAGGGAGG - Intronic
1037406496 8:18547984-18548006 AGGAAAAAGAATGAAAAGGAAGG - Intronic
1037514114 8:19612511-19612533 AGGCCCAAGAAAAAGGAGGAGGG + Intronic
1037597904 8:20369759-20369781 AGTAAGAAGAAAGAGAAGGAAGG - Intergenic
1037638381 8:20720658-20720680 AAGATCAAGAATGAGGAAAAGGG + Intergenic
1037746200 8:21646885-21646907 AGGAACAAGAAGCGGGAGGGAGG + Intergenic
1037829346 8:22178787-22178809 AGGAAGGAGTTTGAGGAGGAGGG - Intronic
1038009408 8:23462902-23462924 AAGAAGAAGAAAGAGAAGGACGG - Intergenic
1038059127 8:23892736-23892758 AGGAACTTGAAGGAGGAGCATGG + Intergenic
1038232413 8:25714789-25714811 AGGAAAGGGAAGGAGGAGGAAGG - Intergenic
1038284965 8:26198493-26198515 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1038379806 8:27081917-27081939 AGAAACCAGAATGGGGAAGAGGG + Intergenic
1039005807 8:33035739-33035761 AGGAACACAAATGAGGCTGAGGG + Intergenic
1039213325 8:35239749-35239771 AGGTATCAGAAGGAGGAGGAAGG - Intronic
1039258105 8:35741013-35741035 ATGAATGAGAGTGAGGAGGATGG - Intronic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1040095910 8:43442340-43442362 AGGAAAAATAACGAGGAGAAGGG - Intergenic
1040498206 8:47984962-47984984 GGGAGCAGGAAGGAGGAGGAGGG + Intergenic
1040588413 8:48765745-48765767 AGGAGCAAGGATGGGCAGGAAGG + Intergenic
1040904435 8:52451388-52451410 AGGAAAATGGATGAGTAGGAAGG + Intronic
1041057188 8:53998475-53998497 GGGACCAGGAATGAGGGGGAAGG + Intronic
1041291175 8:56310146-56310168 AGGAGGAAGGAGGAGGAGGAGGG + Intronic
1041291185 8:56310178-56310200 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291190 8:56310194-56310216 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291195 8:56310210-56310232 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291200 8:56310226-56310248 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291205 8:56310242-56310264 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291210 8:56310258-56310280 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291215 8:56310274-56310296 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291220 8:56310290-56310312 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041291224 8:56310303-56310325 AGGAGGAAGGAGGAGGAGGAAGG + Intronic
1041291229 8:56310319-56310341 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1041311888 8:56525510-56525532 AGAAACTAGAAAGAGGAAGATGG + Intergenic
1041799320 8:61781705-61781727 AGAAACAATAACTAGGAGGAAGG + Intergenic
1042130425 8:65582480-65582502 AAGAAGAAGAAGGAGGAGAAGGG + Intergenic
1042144719 8:65715890-65715912 AGGCAGGAGAATGAGGAGAATGG + Intronic
1042388282 8:68202961-68202983 TGGAACAAAAAGGAAGAGGAAGG - Intronic
1042662444 8:71169949-71169971 AGGAACAGTAATGAGGGGAAAGG - Intergenic
1042889335 8:73589969-73589991 GGGAAGAAGAAAGAGGAGGGAGG + Intronic
1042913579 8:73851978-73852000 AGGAAAGAGAAGGTGGAGGAAGG + Intronic
1043080897 8:75763708-75763730 AGAAAAAAGAATGAAAAGGAAGG + Intergenic
1043138931 8:76563816-76563838 AGGGACTAGAATGAGGTGGTGGG - Intergenic
1043503952 8:80884610-80884632 AGGAAGAAGAAGAAAGAGGAAGG + Intergenic
1043703341 8:83318491-83318513 AAAAAGAAGAAAGAGGAGGAGGG - Intergenic
1043727869 8:83633957-83633979 AAGAAAAAAAAAGAGGAGGAAGG - Intergenic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1043938293 8:86168005-86168027 AGGAAGAGGAATGAGAAGGAAGG + Intergenic
1044191429 8:89323119-89323141 AAGAACAAGAATGAAAAAGAGGG + Intergenic
1044228893 8:89751441-89751463 AGGATGAAGAAAGAAGAGGAAGG + Intergenic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1045015062 8:97994221-97994243 AGGAAGGAGAAGGGGGAGGAAGG + Intronic
1045077929 8:98590550-98590572 AGGAGCAAAAAGCAGGAGGACGG + Intronic
1045316665 8:101049308-101049330 AAGAAAAAGAAAGAGAAGGAAGG - Intergenic
1045536293 8:103031489-103031511 AGGAGCAAGAGTCAGGGGGAAGG + Intronic
1046141317 8:110096676-110096698 AAGAAGAAGAATCAGAAGGAGGG + Intergenic
1046286981 8:112106981-112107003 AAGAAGAAAAATGAAGAGGAAGG + Intergenic
1046485897 8:114888285-114888307 AGGAAGGAGAAAGGGGAGGAAGG - Intergenic
1046558441 8:115806744-115806766 AAGAAGAAGAAAGAGAAGGAAGG + Intronic
1046558452 8:115806845-115806867 AGGAAGAAGAATAAGAAGGAAGG + Intronic
1046710250 8:117503293-117503315 AGGAAGAAGAAGGAGGAGGAGGG + Intergenic
1046721783 8:117628261-117628283 AGCAGCAAGGATGAGGTGGAGGG + Intergenic
1046888245 8:119392869-119392891 AGAAAGAAGAAAGAGGAGGAAGG - Intergenic
1046979287 8:120319100-120319122 AGGAAGAAAAATGAGCAGTAAGG - Intronic
1047127082 8:121974513-121974535 AGGAAAAAGAAGAAGAAGGAAGG - Intergenic
1047553983 8:125908852-125908874 AGGAGCAAGAAAGAGAGGGACGG - Intergenic
1047836756 8:128702108-128702130 AGTAAAAAGAATGTGGAGGAAGG - Intergenic
1047852311 8:128870347-128870369 AGGAGCAAGAATGAGAAGAATGG - Intergenic
1047956559 8:129981041-129981063 GGGAAGAAGACAGAGGAGGAAGG + Intronic
1047984779 8:130221277-130221299 AGGAAGAAGGGAGAGGAGGATGG + Intronic
1048074278 8:131052179-131052201 AGGCAAAAGAGTGAGAAGGAAGG + Intergenic
1048103651 8:131383159-131383181 AGGAACAAGAAGGAGTGGGGAGG + Intergenic
1048119858 8:131567635-131567657 AGGAGCAAGAAAGAAGAGAAAGG + Intergenic
1048210205 8:132448551-132448573 AGTAAAAAGGAGGAGGAGGAAGG + Intronic
1048317294 8:133371606-133371628 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1048394616 8:134002249-134002271 AGGATCTAGAATGACCAGGAGGG - Intergenic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1048689053 8:136938001-136938023 AAGAACAAGACAGAGAAGGAAGG - Intergenic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1048709648 8:137195156-137195178 AGAAAAAAGAAAGAGGAGGAGGG + Intergenic
1049353803 8:142177925-142177947 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1049487164 8:142872092-142872114 AGGCACAAGACTGAGGCAGAGGG + Intronic
1050361525 9:4835528-4835550 AGGAAAGAGAAGGAGAAGGAAGG + Intronic
1050469560 9:5972607-5972629 GGTAACAAGAGAGAGGAGGAAGG - Intronic
1050475921 9:6041008-6041030 AGAAAGAGGAATGAGGAGGAAGG - Intergenic
1050475925 9:6041031-6041053 AGAAAGAGGAAGGAGGAGGAAGG - Intergenic
1050498620 9:6270657-6270679 AGAAACAGAAATGAGGAGGTGGG + Intergenic
1050660894 9:7881334-7881356 AGAAAGAAGAATGAAAAGGAAGG + Intronic
1051160812 9:14205194-14205216 AGGAACAAAAATTGGAAGGAAGG + Intronic
1051189121 9:14492565-14492587 AGGAAGAAGAGGGAGGGGGAAGG + Intergenic
1051247521 9:15126702-15126724 AGGAAGGAGAAGGAGGGGGAAGG + Intergenic
1051336490 9:16070641-16070663 AGGAGCAAGAAAGAGGAGAGAGG + Intergenic
1051389684 9:16551013-16551035 GGGAACAAGATCTAGGAGGAAGG - Intronic
1051863710 9:21654796-21654818 TGGAACAAAAAGGTGGAGGAAGG - Intergenic
1051901295 9:22044692-22044714 AGGCACAGGAAGGAGGGGGAGGG - Intergenic
1052003685 9:23320234-23320256 AGAAAGAAGGAAGAGGAGGAGGG + Intergenic
1052075097 9:24131646-24131668 AGGAAAGAAAATGAGAAGGATGG + Intergenic
1052094230 9:24365011-24365033 AGCAAAAGGAATGAAGAGGAAGG - Intergenic
1052111904 9:24596161-24596183 AGGAAAAACAAAGAGGGGGAGGG - Intergenic
1052673824 9:31593768-31593790 AGGAATAAGAAAGAAGACGAGGG + Intergenic
1052704804 9:31981866-31981888 AGCAACTAGAATGGGGGGGATGG + Intergenic
1052713884 9:32091413-32091435 AGCAGCAAGAAAGAGGAAGATGG - Intergenic
1053134530 9:35641979-35642001 GGGAACTAGAATTAGGAGAAGGG - Intronic
1053239566 9:36485873-36485895 AAGAGCGAGAATGAGGGGGAGGG + Intronic
1053448615 9:38173146-38173168 AGGACCCAAAATGAGGATGAAGG - Intergenic
1053832152 9:42094725-42094747 AGGAAGGAGAAGGAGGAGGAAGG + Intronic
1053885766 9:42644329-42644351 GGGAACAGGGATGAGCAGGAAGG - Intergenic
1054130776 9:61362147-61362169 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1054224784 9:62451778-62451800 GGGAACAGGGATGAGCAGGAAGG - Intergenic
1054598393 9:67092699-67092721 AGGAAGGAGAAGGAGGAGGAAGG - Intergenic
1054747362 9:68868245-68868267 AGGATAAAGAAGAAGGAGGATGG + Intronic
1054887929 9:70219403-70219425 AGAAGTAAGAATGAGTAGGAAGG - Intronic
1055080274 9:72261824-72261846 AGGAGGAAGAAGGAGGAGGAGGG - Intergenic
1055086057 9:72315310-72315332 AGGAGCGACCATGAGGAGGATGG + Intergenic
1055561207 9:77523366-77523388 AGGAACAAGGCTGGGGAGGGAGG + Intronic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056009902 9:82317043-82317065 TAGAACAAAAATGTGGAGGAAGG + Intergenic
1056109176 9:83377616-83377638 AGGAGCAGGAGAGAGGAGGAAGG - Intronic
1056342694 9:85653229-85653251 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056651418 9:88467580-88467602 ATGAACAACAAGGAGGAAGATGG + Intronic
1056779809 9:89540997-89541019 TGGAACAAAAAGGTGGAGGAAGG - Intergenic
1057013869 9:91633087-91633109 AGGAACAGAAAGGAAGAGGAGGG + Intronic
1057013982 9:91634034-91634056 ATGAACAAGAATGATGAGATTGG - Intronic
1057336567 9:94160321-94160343 TGGAACAAAAAGGTGGAGGAGGG - Intergenic
1057525869 9:95800594-95800616 GGGACCAGGTATGAGGAGGAGGG + Intergenic
1057748068 9:97767611-97767633 AGGAAGGAGAGAGAGGAGGAAGG - Intergenic
1057837558 9:98457567-98457589 GGGTACAAGGATCAGGAGGAGGG + Intronic
1057936602 9:99244887-99244909 AGGAAATAGAGTGAGGAGAAGGG + Intergenic
1058561434 9:106233138-106233160 AGGAGAAAGGAGGAGGAGGAAGG - Intergenic
1058561442 9:106233174-106233196 AGGAGGAAGAAGGAGGAGAAAGG - Intergenic
1058561453 9:106233233-106233255 AGGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058563027 9:106249883-106249905 AGGAAGAAGAAGGAAGAAGAAGG - Intergenic
1058955273 9:109941086-109941108 AGGAAGAAAAAAGAAGAGGAAGG - Intronic
1059015128 9:110506937-110506959 AGGGAAAAGAAAGAGGAAGATGG + Intronic
1059072451 9:111152917-111152939 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072458 9:111152943-111152965 AGGAAGCAGGAGGAGGAGGAAGG + Intergenic
1059072463 9:111152959-111152981 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059072467 9:111152972-111152994 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072471 9:111152985-111153007 AGGAGGAAGGAGGAGGAGGAAGG + Intergenic
1059072476 9:111153001-111153023 AGGAAGGAGGAGGAGGAGGAAGG + Intergenic
1059677467 9:116553122-116553144 AAGAAGAAGAAAGAGGAGGAAGG - Intronic
1059811410 9:117859523-117859545 AAGATGAAGATTGAGGAGGATGG + Intergenic
1059823218 9:117997225-117997247 AGGAGGAGGAAGGAGGAGGAAGG - Intergenic
1059823221 9:117997235-117997257 AGGAAGGAGGAGGAGGAGGAAGG - Intergenic
1060272312 9:122153719-122153741 AAAAGGAAGAATGAGGAGGATGG - Intronic
1060396063 9:123317832-123317854 AGGAAAAAGCCTGAGGAGGCTGG + Intergenic
1060623584 9:125090395-125090417 AGGAAGGAGGATGATGAGGAAGG + Intronic
1061053222 9:128208035-128208057 AAAAAAAAGAATGGGGAGGAAGG - Intronic
1061313576 9:129779725-129779747 AGGAAAAAGAGAGAGAAGGAGGG + Intergenic
1062074723 9:134579738-134579760 AAAAAGAAGAAGGAGGAGGAGGG + Intergenic
1062097860 9:134712113-134712135 GGGAACAGGAAGGAGGGGGAAGG - Intronic
1062638401 9:137503550-137503572 AGGAGGGAGAAGGAGGAGGAAGG + Intronic
1062638457 9:137503850-137503872 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1062638470 9:137504014-137504036 AAGAAGAAGAAGGAGGAGGAAGG + Intronic
1203486677 Un_GL000224v1:62580-62602 AGGAACCAAAAGGAGGAGGCAGG - Intergenic
1203499299 Un_KI270741v1:4480-4502 AGGAACCAAAAGGAGGAGGCAGG - Intergenic
1185661926 X:1735195-1735217 AGGAGGAAGGAGGAGGAGGAGGG - Intergenic
1185662082 X:1735763-1735785 AGGAGGGAGAAAGAGGAGGAGGG - Intergenic
1185662086 X:1735779-1735801 AGGAGGGAGAAAGAGGAGGAGGG - Intergenic
1185662094 X:1735809-1735831 AGGAGGGAGAAAGAGGAGGAGGG - Intergenic
1185795232 X:2959084-2959106 AGGAAGAACAATGAAGAAGAGGG - Intronic
1185830057 X:3292881-3292903 AGGAAGAAGAAGGAAGAAGAAGG + Intergenic
1185913791 X:4011641-4011663 AGGAGCAGGAAGGAGAAGGAAGG - Intergenic
1186047325 X:5550482-5550504 AACAACAAGAAGGAGGAGGAGGG - Intergenic
1186225585 X:7395867-7395889 AGCAAGAAGAAGAAGGAGGAAGG - Intergenic
1186402628 X:9273769-9273791 AGAAACAGGAAAGAGGAAGAAGG + Intergenic
1186463474 X:9766061-9766083 AGGAAGAGGGAGGAGGAGGAGGG + Intronic
1187025676 X:15433610-15433632 AGGAGAAAGAAGGAGGAGAAAGG + Intronic
1187025685 X:15433659-15433681 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025690 X:15433682-15433704 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025695 X:15433705-15433727 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025700 X:15433728-15433750 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025705 X:15433751-15433773 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025710 X:15433774-15433796 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025715 X:15433797-15433819 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025720 X:15433820-15433842 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025725 X:15433843-15433865 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025729 X:15433863-15433885 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025734 X:15433886-15433908 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187025752 X:15433955-15433977 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025761 X:15433998-15434020 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025765 X:15434018-15434040 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025770 X:15434041-15434063 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025774 X:15434061-15434083 AGGAGAAAGAAGGAGGAGGAAGG + Intronic
1187025785 X:15434101-15434123 AGGAGAAAGAAGGAGGAGGAGGG + Intronic
1187025791 X:15434127-15434149 AGAAAGAAGGAGGAGGAGGAAGG + Intronic
1187025805 X:15434227-15434249 AGATAGAAGAAGGAGGAGGAAGG + Intronic
1187025827 X:15434373-15434395 AGAAAAAAGAAGGAGGAGAAAGG + Intronic
1187264586 X:17719142-17719164 AGGAATAATAAGGAGAAGGAAGG + Intronic
1187755428 X:22520473-22520495 GGGAGCGAGAATGAGAAGGAAGG - Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1188207475 X:27378315-27378337 AGGCAGCAGAATGAGGAGAATGG + Intergenic
1188520596 X:31033695-31033717 TGGAAGAAGAATGAAGAGGCAGG - Intergenic
1188562626 X:31486760-31486782 AGGAACAAGAATGATGACGTAGG - Intronic
1188651227 X:32633800-32633822 AGGAGCAAGAGTGAGAGGGAGGG + Intronic
1188727938 X:33607858-33607880 AGCAACAATAAAGAGGATGAGGG + Intergenic
1188854636 X:35177993-35178015 AGAAACAAGAAATAGGAGCAAGG - Intergenic
1189158949 X:38790835-38790857 AGAAACAAGAAGGAAGAGGCTGG + Intergenic
1189254897 X:39630192-39630214 AGGAAGGAGAATGAGGGGGCTGG - Intergenic
1189321167 X:40088457-40088479 GGGAAAAAGAGGGAGGAGGAGGG + Intronic
1189364737 X:40379939-40379961 AGGAGGAAGAGGGAGGAGGAAGG - Intergenic
1190240411 X:48653805-48653827 AGGAACAGGAGGGAGGAGGAGGG + Intergenic
1190282035 X:48937353-48937375 AGGAACAAAGATGAGAATGAAGG + Intronic
1190517141 X:51235559-51235581 AGGAGCAAGAATGTGTAGCACGG + Intergenic
1190584333 X:51922896-51922918 AAAAACATGAAAGAGGAGGAAGG + Intergenic
1190751907 X:53369491-53369513 AAAAACAAAAATCAGGAGGAGGG + Intergenic
1191108378 X:56786593-56786615 AGAAAGAAGAAGGAGGAGGGAGG - Intergenic
1191108379 X:56786596-56786618 AGGAGAAAGAAGAAGGAGGAGGG - Intergenic
1191109872 X:56796089-56796111 AGGGACAAGAAAGATGAAGAGGG - Intergenic
1191110045 X:56797150-56797172 AAGAAGAAGAAGGAGAAGGAGGG - Intergenic
1191598189 X:62971250-62971272 AGGAAAAAAAATGAGGAGAAGGG + Intergenic
1191610884 X:63111757-63111779 CCGAAAAAAAATGAGGAGGAAGG + Intergenic
1191910712 X:66146666-66146688 AGGAGGAAGAATGAGATGGAGGG - Intergenic
1191961752 X:66711109-66711131 AGGAACAGGAAGTAGGAAGAGGG - Intergenic
1192106013 X:68317664-68317686 AGGAAGGAGGAGGAGGAGGAAGG + Intronic
1192185181 X:68941831-68941853 AGGAGAAAGGAGGAGGAGGAAGG + Intergenic
1192318320 X:70068245-70068267 AGGAAATAGACTGAGGAGCAAGG + Intergenic
1192557012 X:72098278-72098300 AGGAATAAGAAAGAGGAAGTTGG + Intergenic
1192561388 X:72130288-72130310 AGGAACAAGAATGAGGAGGAAGG - Exonic
1193103030 X:77637055-77637077 AGAAAGAAGAAGGAGGAAGAAGG + Intronic
1193466896 X:81859642-81859664 AGGAAAAAGACTGATGAGAATGG - Intergenic
1193905027 X:87231820-87231842 ATGAGCAAGGATGAGGAGCAAGG + Intergenic
1194058059 X:89162680-89162702 AGAAAAAAGAATGAAAAGGAAGG - Intergenic
1194407037 X:93509361-93509383 AGGAGGAACAAGGAGGAGGAAGG + Intergenic
1195294589 X:103463492-103463514 AGGAAGAGGAAGAAGGAGGAGGG + Intergenic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195481319 X:105348793-105348815 GAGAACAAGAATTAGGAGAAAGG + Intronic
1195522199 X:105844226-105844248 AGGAACATACATGAGTAGGAAGG + Intronic
1195825910 X:109000474-109000496 AGGCTCAAGAATGAGGATTAAGG - Intergenic
1195964095 X:110414409-110414431 AGGAAAAAGGATGAGGGGAAAGG + Intronic
1196313858 X:114199645-114199667 AGGAAAAAGAAAAAGAAGGAGGG + Intergenic
1196322858 X:114363250-114363272 GGCAATAAGAATGAAGAGGAAGG + Intergenic
1197182086 X:123547627-123547649 AGGAAGAAGAAAGAAGAAGAAGG + Intergenic
1197742762 X:129908023-129908045 AGGAAAAACAATCAGGATGAGGG - Intronic
1197912681 X:131501597-131501619 AGGAACAAGAACTAATAGGATGG + Intergenic
1198094141 X:133361833-133361855 AAGAGAAAGAATGAGGAGGCAGG + Intronic
1198202258 X:134433709-134433731 AGCAATAAGAATGGAGAGGATGG - Intergenic
1198311813 X:135432493-135432515 GGGAAGAAGAAGGAAGAGGAAGG - Intergenic
1198339400 X:135699484-135699506 AGGAATCTGAATGAGGAGGAAGG + Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198644445 X:138790471-138790493 AGGAAAAAGACTGTGGAGGCAGG - Intronic
1198721835 X:139630656-139630678 AAGAACAAGTATGAGGAAAATGG + Intronic
1198852541 X:140980497-140980519 AAGAAGAATAATGAAGAGGAAGG - Intergenic
1199161292 X:144615045-144615067 AGGAGCAAGAAAGAGGAGGGAGG - Intergenic
1199286010 X:146054905-146054927 AGGAAGAGGAAGGAGGAGGAGGG + Intergenic
1199784207 X:151089879-151089901 AACATCAAGAATGAGGAGAAGGG - Intergenic
1199841465 X:151653691-151653713 AAGAAGAAGAAGGAGGAGGAGGG - Intronic
1199855220 X:151753988-151754010 AGATACAAGAGTGAGGAGGCAGG + Intergenic
1200451378 Y:3333366-3333388 AGGAGCGGGAACGAGGAGGATGG - Intergenic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201541060 Y:15105448-15105470 AAGAAGAAGAAAGAAGAGGAGGG - Intergenic