ID: 1192567516

View in Genome Browser
Species Human (GRCh38)
Location X:72177805-72177827
Sequence CAGAGCTCTCACAGTGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192567514_1192567516 29 Left 1192567514 X:72177753-72177775 CCATGGACACAGGCTTATTATCA No data
Right 1192567516 X:72177805-72177827 CAGAGCTCTCACAGTGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192567516 Original CRISPR CAGAGCTCTCACAGTGTTCC AGG Intergenic
No off target data available for this crispr