ID: 1192573529

View in Genome Browser
Species Human (GRCh38)
Location X:72225013-72225035
Sequence ACCAGATGGCTCCTATAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192573519_1192573529 20 Left 1192573519 X:72224970-72224992 CCACCCATTCTCCCCATAATACT No data
Right 1192573529 X:72225013-72225035 ACCAGATGGCTCCTATAGACTGG No data
1192573523_1192573529 8 Left 1192573523 X:72224982-72225004 CCCATAATACTCCTATTCTCCCA No data
Right 1192573529 X:72225013-72225035 ACCAGATGGCTCCTATAGACTGG No data
1192573524_1192573529 7 Left 1192573524 X:72224983-72225005 CCATAATACTCCTATTCTCCCAA No data
Right 1192573529 X:72225013-72225035 ACCAGATGGCTCCTATAGACTGG No data
1192573521_1192573529 16 Left 1192573521 X:72224974-72224996 CCATTCTCCCCATAATACTCCTA No data
Right 1192573529 X:72225013-72225035 ACCAGATGGCTCCTATAGACTGG No data
1192573520_1192573529 17 Left 1192573520 X:72224973-72224995 CCCATTCTCCCCATAATACTCCT No data
Right 1192573529 X:72225013-72225035 ACCAGATGGCTCCTATAGACTGG No data
1192573517_1192573529 22 Left 1192573517 X:72224968-72224990 CCCCACCCATTCTCCCCATAATA No data
Right 1192573529 X:72225013-72225035 ACCAGATGGCTCCTATAGACTGG No data
1192573525_1192573529 -3 Left 1192573525 X:72224993-72225015 CCTATTCTCCCAATCAAAAAACC No data
Right 1192573529 X:72225013-72225035 ACCAGATGGCTCCTATAGACTGG No data
1192573522_1192573529 9 Left 1192573522 X:72224981-72225003 CCCCATAATACTCCTATTCTCCC No data
Right 1192573529 X:72225013-72225035 ACCAGATGGCTCCTATAGACTGG No data
1192573518_1192573529 21 Left 1192573518 X:72224969-72224991 CCCACCCATTCTCCCCATAATAC No data
Right 1192573529 X:72225013-72225035 ACCAGATGGCTCCTATAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192573529 Original CRISPR ACCAGATGGCTCCTATAGAC TGG Intronic