ID: 1192575272

View in Genome Browser
Species Human (GRCh38)
Location X:72238747-72238769
Sequence CCTGGGGACCCGAACTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192575272_1192575287 15 Left 1192575272 X:72238747-72238769 CCTCAACAGTTCGGGTCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1192575287 X:72238785-72238807 CCCCACCTCCACCCTGGGCCAGG 0: 1
1: 1
2: 16
3: 153
4: 1554
1192575272_1192575283 9 Left 1192575272 X:72238747-72238769 CCTCAACAGTTCGGGTCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1192575283 X:72238779-72238801 GGGCCACCCCACCTCCACCCTGG 0: 1
1: 1
2: 4
3: 62
4: 602
1192575272_1192575290 19 Left 1192575272 X:72238747-72238769 CCTCAACAGTTCGGGTCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1192575290 X:72238789-72238811 ACCTCCACCCTGGGCCAGGTCGG 0: 1
1: 0
2: 1
3: 22
4: 261
1192575272_1192575284 10 Left 1192575272 X:72238747-72238769 CCTCAACAGTTCGGGTCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1192575284 X:72238780-72238802 GGCCACCCCACCTCCACCCTGGG 0: 1
1: 1
2: 5
3: 72
4: 587

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192575272 Original CRISPR CCTGGGGACCCGAACTGTTG AGG (reversed) Intronic
900614955 1:3561294-3561316 CCTGGGGACCCAAGCTGGAGAGG + Intronic
900674183 1:3873856-3873878 GCTGGGGACCAGAAGTGTTTTGG - Intronic
900749131 1:4383071-4383093 CCTGGGGACCCCTAATCTTGCGG + Intergenic
902645647 1:17796139-17796161 CCTGGGGACCCCAGCTGCTCTGG + Intronic
902891884 1:19450261-19450283 GCTGGGGACCTGAAGTGTTTTGG + Intronic
905783891 1:40737158-40737180 CCTGGGGACCAGAAATGTCTGGG - Intronic
906108548 1:43308689-43308711 CCTAGGGACCAGAAATGATGAGG + Intronic
910656771 1:89627995-89628017 CCTTGGGACCAGAAGTGTTCTGG - Intergenic
910921735 1:92355862-92355884 GCTTGGGACCAGAACTGTTTTGG - Intronic
912732817 1:112124898-112124920 CCTGGGGACTGGAGCTTTTGGGG - Intergenic
913114278 1:115682208-115682230 CCTGGAGACCAGAAGTGTGGTGG + Intronic
918043483 1:180927238-180927260 CCTGTGGACCCTCACTGTTGAGG + Intronic
922459050 1:225800774-225800796 GCTGGGCACCAGAAATGTTGGGG + Intergenic
1064187722 10:13177351-13177373 GCTTGGGACCAGAACTGTTTTGG + Intronic
1066255649 10:33676192-33676214 CCTGGGGACCTGTACCGGTGTGG + Intergenic
1067040912 10:42952793-42952815 CCTGGGGACTAGGACAGTTGGGG - Intergenic
1067265172 10:44735537-44735559 GCTGGGGACCCCAACTGTAGTGG + Intergenic
1069782581 10:70966042-70966064 CCTGGGGACCATAACTGGGGGGG + Intergenic
1072655710 10:97328916-97328938 CCTGGGCAGCCTAACAGTTGGGG - Intergenic
1074372465 10:112911185-112911207 CCTGGAGACCCACACTGTTTGGG - Intergenic
1075070407 10:119316488-119316510 CCTGGGGACCCCCACCCTTGTGG - Intronic
1078454340 11:11463506-11463528 CCTGGGAGCCCTAGCTGTTGTGG + Intronic
1085465667 11:76721746-76721768 TCTGGGGACCCGTACTGTGGGGG + Intergenic
1087294492 11:96354879-96354901 CCTGGTGACCCTGACTTTTGTGG + Intronic
1089215752 11:116833723-116833745 CCTTGGGACCCGGACTGGAGTGG + Intergenic
1089604006 11:119631226-119631248 CCTGGGGATAAGAACTTTTGTGG - Intronic
1091399798 12:174959-174981 CCTGGGGGACAGAACTGGTGAGG - Exonic
1091971090 12:4787798-4787820 CCTGAGGACCCAAACATTTGGGG - Intronic
1092133419 12:6128555-6128577 CCTGAGGGCCAGAAGTGTTGAGG - Intergenic
1093617256 12:21241389-21241411 CCTGTGGGCCTGAAGTGTTGTGG + Intergenic
1103097644 12:118144812-118144834 CTTGGGGACCTGAACTGTCCTGG + Exonic
1103527205 12:121576960-121576982 CCTGGGGATCTGAGCTGCTGAGG - Intronic
1105057480 12:133115805-133115827 ACTTGGGACCAGAACTGTTTTGG + Exonic
1105301839 13:19142278-19142300 CCTGGGGAACGGAACTGGTTGGG + Intergenic
1107481665 13:40790212-40790234 CCAGGGAACACGAACTGCTGCGG - Intronic
1113728388 13:112622639-112622661 CCTGGGGACAGGGACTGTGGTGG - Intergenic
1115981925 14:39062237-39062259 GCTTGGGACCCGAAATGTTTTGG + Intronic
1121592538 14:95127399-95127421 GCTTGGGACCTGAACTGTTTTGG + Intronic
1202903786 14_GL000194v1_random:57255-57277 CCTGAGGACCCAAACTCTGGGGG + Intergenic
1124447878 15:29754668-29754690 GCTTGGGACCAGAACTGTTTTGG + Intronic
1125816024 15:42585171-42585193 GCTTGGGACCAGAACTGTTTCGG - Intronic
1131268764 15:90934194-90934216 CCTGGGAACTGGAACTGATGGGG + Intronic
1141608817 16:85170107-85170129 CCTGGGGCCCCGTCCTGGTGGGG - Intergenic
1141873945 16:86808771-86808793 ACTGGGTACCTGAAATGTTGGGG - Intergenic
1143037645 17:4008848-4008870 CCTGGGGGCCAGCTCTGTTGGGG + Intronic
1143381578 17:6499431-6499453 TCTGGGGACTCCAACTCTTGGGG + Intronic
1145252740 17:21305186-21305208 CCTGGGGCCCTGAGCTTTTGGGG + Intronic
1145323834 17:21782723-21782745 CCTGGGGCCCTGAGCTTTTGGGG - Intergenic
1157770044 18:50337871-50337893 CCTGTGGAGCCAAACTGTTCTGG - Intergenic
1158048626 18:53188195-53188217 CCTGGGGACCAGAGCTTTTAAGG + Intronic
1160535699 18:79590216-79590238 CCTGGGGACCCGGGCAGTGGGGG + Intergenic
1167239437 19:48334330-48334352 TCTGGGGACCCGTACTGAAGAGG - Intronic
1167533185 19:50031702-50031724 CTTGGGGACAGGAACTGATGGGG + Intronic
928015982 2:27657533-27657555 CCTGGAGACCCTAACTGATGTGG - Exonic
929783038 2:44969988-44970010 CCTGGGCACTCCAACTGTTATGG + Intergenic
931613187 2:64126004-64126026 CCTTGGGACCGGAAGTGTTTTGG - Intronic
933711178 2:85327260-85327282 CCTCCGCACCCGACCTGTTGGGG + Exonic
933712966 2:85341244-85341266 CTTGGGGACCTGAACTGTTCTGG - Intergenic
934502868 2:94873157-94873179 CCTGAGGACCCAAACTCTGGGGG - Intronic
936254993 2:110903896-110903918 TCTGGGGACCCTAAGTCTTGAGG + Intronic
938114491 2:128594090-128594112 CCTGGGCACCCGAGCAGCTGTGG + Intergenic
938306239 2:130257199-130257221 CCTTGGGACCAGAAGTATTGTGG + Intergenic
938981579 2:136532144-136532166 CATGGGGACCAGAACAGATGTGG + Intergenic
941705864 2:168657626-168657648 CCTGTGGACCGGCACTGCTGGGG + Intronic
943491759 2:188562077-188562099 CCTGGGGCCCAGAAGTGCTGAGG - Intronic
944926851 2:204474276-204474298 CCTTAGGACCCGAAATGCTGGGG - Intergenic
948382684 2:237561732-237561754 ACTTGGGACCAGAACTGTTTTGG + Intergenic
1174215322 20:48911977-48911999 TCTGGGGAACCTAACTGTAGTGG - Intergenic
1175044555 20:56092948-56092970 CCTGGGGACCCATAAAGTTGAGG - Intergenic
1181087507 22:20448365-20448387 GCTGGGGACCAGAAGTGTTTTGG - Intronic
1181867260 22:25868616-25868638 CCTGGGGACCCCAAGTGGTTTGG + Intronic
1184093597 22:42304934-42304956 CCAGGGGCCCCGTACTCTTGGGG + Intronic
1184186386 22:42867913-42867935 CTTGGGGACCCGAAGAGGTGTGG + Intronic
1184766033 22:46573077-46573099 CCTGGGAGCCCTGACTGTTGAGG + Intergenic
953333387 3:42073139-42073161 CCTGGGGCCCCTAGCTGTTCTGG + Intronic
955401937 3:58598379-58598401 CCTGGAGACCAGAACTGTAGAGG - Intronic
959032447 3:101315646-101315668 GCTTGGGACCAGAAGTGTTGTGG - Intronic
962480286 3:135792291-135792313 CCTGGGCACTCGCACTGTTTGGG + Intergenic
962566082 3:136661640-136661662 CTTGGGGACCAGAAGTGTTTTGG - Intronic
964427593 3:156569561-156569583 CCTGGGGACCACACCTGGTGGGG + Intergenic
967862527 3:194162647-194162669 GCTTGGGACCAGAAGTGTTGTGG + Intergenic
968055100 3:195685265-195685287 CCTTGGGACCAGAAGTGTTTTGG + Intergenic
971170426 4:24227822-24227844 ACTGAGCACCCGAATTGTTGGGG + Intergenic
976303465 4:83536553-83536575 CCTGGGGACAGGGACTGCTGTGG + Exonic
985502274 5:255904-255926 CCTTGGGACCAGAAGCGTTGTGG + Intronic
998100215 5:139426649-139426671 ACTGGGAACCCGAACTGAGGGGG - Intronic
1001596483 5:172902112-172902134 CCTGGGGCCCTGAAATGCTGGGG - Intronic
1014247103 6:119080592-119080614 GCTTGGGACCCAAACTGTTCTGG + Intronic
1020423270 7:8034955-8034977 CCTGTGGACCCGAGCTGTGATGG + Intronic
1021992941 7:26154176-26154198 CCTGGGGACCGGAACCAATGGGG + Intronic
1023962400 7:44937820-44937842 CCTGGGGCCCAGCAATGTTGTGG - Intergenic
1024320074 7:48056694-48056716 CCTTGGGACCAGAAGTGTTTGGG - Intronic
1037542912 8:19889412-19889434 CCTGGAGCCCTGAACTGTGGTGG - Intergenic
1038307490 8:26417775-26417797 CCTTGGGACCCGAAGTGCTTTGG - Intronic
1042211375 8:66384188-66384210 GCTTGGGACCAGAACTGTTCTGG + Intergenic
1045362934 8:101449692-101449714 ACTGGGCACACAAACTGTTGGGG - Intergenic
1045420551 8:102010350-102010372 CCTGGGCACCACACCTGTTGGGG - Intronic
1049646425 8:143737896-143737918 CCCTGGGCCCCGAACTGCTGAGG - Intergenic
1051731437 9:20147290-20147312 CCTGGGGATCCTAACTTTGGAGG - Intergenic
1053062962 9:35045656-35045678 CCTGGGGACCCGAAGCTTTGGGG - Exonic
1055197589 9:73615126-73615148 CCTAGGGACAAGAACTGGTGTGG + Intergenic
1055433650 9:76270573-76270595 CCTGGGGACCCCTTCTGTGGGGG + Intronic
1056934983 9:90909746-90909768 CCTGGGCACCAGCACTGTTAAGG - Intergenic
1057312055 9:93948922-93948944 CCTGGGGACGCGAAGGGCTGGGG - Intergenic
1059791582 9:117646403-117646425 CCTGGGGACCCTCCCTGGTGTGG - Intergenic
1060371071 9:123072068-123072090 GCTTGGGACCGGAAGTGTTGTGG + Intronic
1061792207 9:133064728-133064750 CCTGGGGCACCCAAATGTTGAGG - Exonic
1203563765 Un_KI270744v1:77030-77052 CCTGAGGACCCAAACTCTGGGGG - Intergenic
1185431938 X:16512-16534 CGGGGGGACCTGAACTGTCGGGG - Intergenic
1185441255 X:229224-229246 CGGGGGGACCTGAACTGTCGGGG - Intergenic
1186399704 X:9246217-9246239 CTTGGTGACCCAAAGTGTTGGGG - Intergenic
1189525619 X:41817544-41817566 CCTTGGGACCAGAAGTGTTTTGG + Intronic
1190759647 X:53428700-53428722 CCAGGGGACCAGAACTGTGTGGG + Intronic
1192575272 X:72238747-72238769 CCTGGGGACCCGAACTGTTGAGG - Intronic
1200223745 X:154405147-154405169 CCAGGGGACTGGCACTGTTGTGG + Intronic
1201159673 Y:11157464-11157486 CCTGAGGACCCAAACTCTGGGGG + Intergenic