ID: 1192575678

View in Genome Browser
Species Human (GRCh38)
Location X:72241393-72241415
Sequence CTCCAGAGGATGCAGCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192575671_1192575678 8 Left 1192575671 X:72241362-72241384 CCTACCATGTAAGGACACACTAT No data
Right 1192575678 X:72241393-72241415 CTCCAGAGGATGCAGCAACAAGG No data
1192575669_1192575678 28 Left 1192575669 X:72241342-72241364 CCTTTTTGCTCTTCTGCTTTCCT No data
Right 1192575678 X:72241393-72241415 CTCCAGAGGATGCAGCAACAAGG No data
1192575668_1192575678 29 Left 1192575668 X:72241341-72241363 CCCTTTTTGCTCTTCTGCTTTCC No data
Right 1192575678 X:72241393-72241415 CTCCAGAGGATGCAGCAACAAGG No data
1192575672_1192575678 4 Left 1192575672 X:72241366-72241388 CCATGTAAGGACACACTATTCCT No data
Right 1192575678 X:72241393-72241415 CTCCAGAGGATGCAGCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192575678 Original CRISPR CTCCAGAGGATGCAGCAACA AGG Intronic