ID: 1192576251

View in Genome Browser
Species Human (GRCh38)
Location X:72245594-72245616
Sequence ATCTCCCAGGGGAAGCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 330}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192576251 Original CRISPR ATCTCCCAGGGGAAGCAGGA AGG Intronic
900226024 1:1534064-1534086 ATCTCCCTGTGGACTCAGGATGG - Exonic
900289400 1:1917506-1917528 AACCCCCAGTGCAAGCAGGAAGG - Intergenic
901819909 1:11822049-11822071 TTCTCCCAGGGGAGAGAGGAAGG + Intronic
901879908 1:12187774-12187796 GGCTCCCAGGAGAAGCAGGCAGG + Intronic
902074978 1:13777263-13777285 ATCCTCCAGGAGAGGCAGGATGG - Intronic
902252128 1:15160880-15160902 ATCCCCCACGGGAGGCAGCAGGG + Intronic
902803511 1:18846290-18846312 GTCTCCCAGAGGAGGGAGGAGGG - Intronic
903221541 1:21872376-21872398 ATCTGGCAGGGGAAAAAGGAGGG + Exonic
903659408 1:24967540-24967562 AGCTGCCAAGGGAAGCAGAAAGG + Intergenic
904224617 1:29005723-29005745 ATCTTCCAGATGAAGAAGGAGGG + Intronic
904298953 1:29541866-29541888 ATCACCCACGGGACACAGGAGGG - Intergenic
904328981 1:29745597-29745619 AACTTCCAGGGGAAGGAGGGTGG + Intergenic
905231552 1:36517657-36517679 ATCTCCCAGGAGCAGGAGGGAGG - Intergenic
905441738 1:38000391-38000413 CTCTCCCAGAGGCAGTAGGAGGG - Intronic
905919769 1:41711684-41711706 AGCTCCAAGGGGTAGCAGGAAGG - Intronic
908020496 1:59893277-59893299 ATCTCACAAAGGAAGCAGGAAGG + Intergenic
910065290 1:83143993-83144015 AGCTCCCAGGGGTAACAGGCAGG - Intergenic
912379926 1:109241849-109241871 AGGACTCAGGGGAAGCAGGATGG - Intergenic
912623457 1:111188801-111188823 AGCTCCGAGGTCAAGCAGGAAGG + Intronic
912633386 1:111268361-111268383 CACTGCCAGGGGATGCAGGAAGG + Intergenic
913690995 1:121279679-121279701 ATTTCCCAGGGGAAGCTTCATGG + Intronic
913971183 1:143419698-143419720 ATATCCCGGGGGCAGCAGAAGGG + Intergenic
914146544 1:145000284-145000306 ATTTCCCAGGGGAAGCTTCATGG - Intronic
914910699 1:151783626-151783648 ATCTCTCTGCGGTAGCAGGAAGG + Intronic
915010302 1:152679117-152679139 ATCTCTCAAGGGCAGGAGGAGGG + Intergenic
915529488 1:156495042-156495064 AGCTCACAGGGACAGCAGGAGGG + Intronic
916579147 1:166092294-166092316 ATCCCCCACTGGAAGGAGGAGGG - Intronic
918340483 1:183564192-183564214 CTCGCCCTGGGGAAGCATGAAGG + Intronic
918414985 1:184297398-184297420 ATCTCCCAAGGTAAGCAGATGGG - Intergenic
919529364 1:198697131-198697153 ATCTCCAAGGACAATCAGGAGGG + Intronic
920209156 1:204315500-204315522 ATCTCCCAGGGGAAGGCAGGTGG + Intronic
920458863 1:206122339-206122361 ATTTCCCAGTGTAAGCAGTAAGG + Intergenic
920478318 1:206298154-206298176 ATTTCCCAGGGGAAGCTTCATGG + Intronic
922573068 1:226645095-226645117 ATGTTCCAGTGTAAGCAGGAGGG - Intronic
924615037 1:245605696-245605718 AGGTCCCAGGGGAAGCAGCAAGG + Intronic
924883452 1:248188011-248188033 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
924883465 1:248188076-248188098 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
924883479 1:248188142-248188164 CTCTCTGAGCGGAAGCAGGATGG + Intergenic
1062841249 10:673631-673653 AGCTCCCTGGGGAAGGAGTATGG - Intronic
1062903438 10:1163019-1163041 GCCTCCCAAGGAAAGCAGGAGGG + Intergenic
1062920234 10:1273830-1273852 ATCTCCCAGGGAAAGCATCCGGG + Intronic
1063115381 10:3068358-3068380 ATCTCCCAGCGGAAACGCGAGGG - Intronic
1063494021 10:6490216-6490238 ACCTCTCAGTGGAGGCAGGAGGG - Intronic
1063556244 10:7082273-7082295 TGCACACAGGGGAAGCAGGAAGG - Intergenic
1063825996 10:9897845-9897867 ACCAGCCAGGGGAAGCATGATGG - Intergenic
1064262721 10:13798945-13798967 ACCTCACTGGGGAAGAAGGAAGG - Intronic
1064644186 10:17444110-17444132 ACTGCCCAGGGGAGGCAGGAAGG - Intronic
1065175032 10:23067746-23067768 ACCTCCCCGTGGAAGCAGGAGGG - Intergenic
1066436410 10:35400065-35400087 ATCTGCGATGGGAAGCAGGCAGG - Intronic
1067247838 10:44561149-44561171 AACTCCCAGTGGAAGGAGGTGGG - Intergenic
1067541374 10:47157042-47157064 ATTTCCCTGGGGTAGCGGGAGGG - Intergenic
1067551644 10:47240553-47240575 ATCCCCTAGGGCAAGCAGGAGGG + Intergenic
1067833066 10:49621361-49621383 GTCTCCCCAGGGAAGAAGGAAGG + Intronic
1069906195 10:71734035-71734057 ACCTGGCTGGGGAAGCAGGAAGG + Intronic
1070088774 10:73262757-73262779 ATATCCCTGGGGAACAAGGAGGG + Intronic
1070646398 10:78205048-78205070 CTTTCCTAGGGGAAGGAGGAAGG - Intergenic
1070747878 10:78945774-78945796 ATCACCCAGGTGTTGCAGGATGG + Intergenic
1070792607 10:79198428-79198450 ACCTGCCTGGGGAAGGAGGAGGG - Intronic
1072438718 10:95435911-95435933 ATCTCCCAGGTGGAGCAGACAGG - Intronic
1073332117 10:102677107-102677129 ACCTCCCAGGAGGAGGAGGAGGG + Intronic
1073775320 10:106778850-106778872 TTCTGCCAGGAGAAGCAGGTGGG - Intronic
1074377650 10:112952269-112952291 ACCTTCCAGGGGAAGGGGGAAGG - Intronic
1074535358 10:114324994-114325016 CTCACCCTGGGGAAGCTGGAAGG - Intronic
1075856962 10:125637946-125637968 ATCACCAAGGGGAAGTTGGAGGG - Intronic
1076563191 10:131380977-131380999 AGCTGCCTGGGGCAGCAGGAAGG + Intergenic
1076581232 10:131513357-131513379 ACTTCCCAGGGGGAGCTGGAAGG - Intergenic
1080825130 11:35842069-35842091 AGTTCCTAGGGGAAGCAGAAAGG - Intergenic
1081296212 11:41392811-41392833 GTGGCCCAGAGGAAGCAGGAAGG + Intronic
1081329979 11:41790675-41790697 ATCCACCAGGGGAAGGAGGTGGG + Intergenic
1083661571 11:64253919-64253941 ATGTCCCAAGGGATGCAGAAGGG + Intronic
1084432655 11:69120163-69120185 AGCCCCCTGGGGAAGCAGGGTGG + Intergenic
1084667012 11:70581997-70582019 AGCTCCTAGGGGAGGCAGGATGG - Intronic
1085509711 11:77082114-77082136 CTGTCCCAGGGGCACCAGGATGG + Intronic
1086336160 11:85802490-85802512 AACTGCCAGGGAAAGTAGGAAGG - Intronic
1089164912 11:116468365-116468387 ATTTCCTGGGGGAAGCTGGATGG + Intergenic
1089335470 11:117720076-117720098 ATCTCTCCGTGGAAGCTGGAAGG + Intronic
1089399485 11:118156237-118156259 ATGCCCCAGGGGAAGTCGGATGG + Intergenic
1089692303 11:120194376-120194398 ACCTCCCAGGGGCAGGAGCAGGG - Intergenic
1089774824 11:120828829-120828851 CTCTCCAAGGGGTAGCAGGCTGG + Intronic
1091168763 11:133502424-133502446 AGCTCCCTGGGAAAGGAGGAGGG + Intronic
1092121185 12:6044990-6045012 ATATCAGAGGGGAAGCAGCAGGG - Intronic
1093345472 12:18035170-18035192 ATATACCAGAGGAAGCAGAATGG + Intergenic
1094494350 12:30980049-30980071 AGCTCCCCGGGGAAGGAGGAAGG - Intronic
1095786107 12:46110252-46110274 ATCACCCAGGGGAAGCATTCTGG - Intergenic
1096504116 12:52082023-52082045 AGGGCCCCGGGGAAGCAGGATGG - Intergenic
1096828234 12:54295381-54295403 TTCCCTCAGGGGAAGCTGGAGGG - Exonic
1102459345 12:113090601-113090623 AGCTCCCGAGGGAGGCAGGATGG - Intronic
1102867163 12:116383476-116383498 TTCTCCCAGGGGAAAGAGAAAGG - Intergenic
1103669700 12:122603301-122603323 ATCTTTAAGGAGAAGCAGGATGG + Intronic
1104062611 12:125281162-125281184 AGCACCCAGGGGAGGGAGGAGGG + Intronic
1106836829 13:33643835-33643857 ATCTCCTGGGGGAAGCAAGGAGG - Intergenic
1107106095 13:36644379-36644401 TTCTCCCAGGGGAGGTGGGAGGG - Intergenic
1107425742 13:40291086-40291108 ATCTCTCAGGAGAAGCAGGAGGG + Intergenic
1108316740 13:49244055-49244077 ATAGCCCAGGGAAAGAAGGAAGG - Intergenic
1110645067 13:77873259-77873281 AGCTGCCAGTGGAAGCATGATGG + Intergenic
1110867019 13:80407563-80407585 ATCTCCCAGGGGAAACTAAAAGG - Intergenic
1111432982 13:88167837-88167859 ATCTCACTTGGGAGGCAGGAAGG + Intergenic
1112374535 13:98826372-98826394 ATCTCCCAGAGGAAGGAGAGGGG - Intronic
1113094420 13:106648714-106648736 GTCTGCCATGGGAAGCAGAATGG - Intergenic
1113203701 13:107893424-107893446 AAATACCAGAGGAAGCAGGATGG - Intergenic
1114613049 14:24054566-24054588 CTGGCCCAGGGGAAGGAGGAAGG - Intronic
1114629490 14:24150096-24150118 GTCTCCCAGGGCCAGCAGGGAGG - Exonic
1118077131 14:62311704-62311726 ATATCTCAGGGGCAGCTGGAAGG + Intergenic
1118886443 14:69870721-69870743 ATCCCATAGTGGAAGCAGGACGG - Intronic
1119568831 14:75651844-75651866 ATGCCCCAGGGCAAGGAGGAAGG + Exonic
1121278723 14:92685375-92685397 TTCTCCCTGGGCAAGCAGGAAGG + Intronic
1121811464 14:96894774-96894796 AGCTCCCAGAGGAACCTGGAGGG + Intronic
1122035974 14:98949752-98949774 AGCCCCCAGGGGAGGCAGGGAGG - Intergenic
1122328867 14:100899577-100899599 CTCTCCCAGGGGAAGGGAGAAGG + Intergenic
1122913180 14:104843641-104843663 ACCCGCCAGGGAAAGCAGGAAGG - Intergenic
1123017388 14:105381912-105381934 AGGTCCGAGGGGAAGCAGGCTGG + Exonic
1124134469 15:27022046-27022068 ATCTACCAGGGGAAGGTGGCAGG - Intronic
1127362576 15:58257794-58257816 ATTTCCCAGAGGATGCTGGAGGG - Intronic
1127596323 15:60486120-60486142 ATCTCACAGGAAAAGCAGAAAGG - Intergenic
1128350304 15:66884044-66884066 TCCTCCCAGGGGATGAAGGAAGG + Intergenic
1128777176 15:70329412-70329434 ATGTCCAAGGGGAGGGAGGAGGG - Intergenic
1129195762 15:73965275-73965297 ATCGTCCTGGGGAAGCAGGTGGG + Intergenic
1129979260 15:79851616-79851638 ATCTACCTAGGGAGGCAGGAGGG + Intronic
1131344831 15:91636930-91636952 ACCTCCCAGGGGACCCAAGACGG + Intergenic
1131558282 15:93418021-93418043 CCCTCCCAGGGGCAGAAGGAAGG + Intergenic
1132485545 16:188734-188756 ATCTCCCATGGGGAGGAGGGAGG - Intergenic
1135136127 16:19886074-19886096 CTCTCCCGGGGGCTGCAGGAAGG + Intronic
1135929976 16:26728075-26728097 CTTTCCCTGGGGAAGCAGGGAGG + Intergenic
1136251687 16:29009537-29009559 ATGTCCCAGGGCCAGGAGGAGGG - Intergenic
1136366121 16:29809982-29810004 GTGTCCCAGGGGAAGCAGGCTGG + Intronic
1136480138 16:30535964-30535986 AGACCCCAGGGGAAGCAGGTTGG - Intronic
1136526598 16:30834992-30835014 AGCTCCCGGGGGAGGCAGCAAGG - Exonic
1136593111 16:31229569-31229591 GTCTCCCTGGGGATGTAGGAAGG + Intergenic
1137542868 16:49377096-49377118 CTCTCGCAGGGGAGGCAGGGAGG - Intronic
1138303653 16:55955115-55955137 CTCTCCCTGGGGCAGAAGGAAGG - Intronic
1139845064 16:69914995-69915017 ATCTCCCAGGAGGAGGAGAAGGG + Intronic
1140020443 16:71233344-71233366 AAATCCTAGGGGAAGAAGGAGGG - Intergenic
1140451296 16:75072882-75072904 ATCTCAGAGGGGAAGCTGGAGGG - Intronic
1141094589 16:81154011-81154033 TTCTCCCAGGGGGAACAGGGTGG + Intergenic
1142106895 16:88309183-88309205 ACCTCTCAGGGGAAGGAGGAAGG + Intergenic
1142120669 16:88385107-88385129 TTCTCCCAGGGGAAGGTGGCAGG - Intergenic
1142490351 17:274453-274475 ATCTCCCAGGGATGACAGGAGGG - Intronic
1143102687 17:4513066-4513088 AGGTCCCCGGGGAGGCAGGAGGG + Intronic
1143509763 17:7388954-7388976 ATCTACCTGTGGAAGCAGGAGGG - Exonic
1144294811 17:13863802-13863824 ATATCCCTGGGAAGGCAGGAGGG + Intergenic
1146176539 17:30668998-30669020 CTCCCCTAGGCGAAGCAGGAAGG - Intergenic
1146350001 17:32085112-32085134 CTCCCCTAGGCGAAGCAGGAAGG - Intergenic
1147629297 17:41919366-41919388 TTCTCCCAAGGGAAGGAGCAAGG - Intronic
1148101896 17:45097283-45097305 CTCTCCCAGACCAAGCAGGATGG - Intronic
1148457985 17:47821172-47821194 ATCTCCCGGTGGAGCCAGGATGG - Intronic
1148677202 17:49452319-49452341 TTCAGTCAGGGGAAGCAGGAAGG - Intronic
1148811642 17:50296693-50296715 TTCTCCCAGGGGAGGGAGAAGGG + Intergenic
1149213468 17:54329039-54329061 AAATCCCAGAGGAAGCAGAATGG + Intergenic
1149313884 17:55421499-55421521 ATCGCCCAGGGACAGCAGGGTGG + Intronic
1149525509 17:57352478-57352500 AGCTCCCAGGTGAAGGAGGGTGG + Intronic
1151364140 17:73606286-73606308 AGCTCCCTGGGGAAGCTGGGTGG + Intronic
1152006979 17:77688495-77688517 AGCCCCCAGGGGATGCAGGTGGG + Intergenic
1152117616 17:78398374-78398396 ATCTGACACAGGAAGCAGGAGGG - Intronic
1152271504 17:79327607-79327629 AGCTCCCAGGTGAGGCAGGTAGG - Intronic
1152742778 17:82025615-82025637 AGAGCCCAGGGGAAGCAGGAAGG + Intronic
1153806438 18:8712341-8712363 AACTCCAATGAGAAGCAGGATGG - Intronic
1154080308 18:11249839-11249861 AACTCCCATGGGAAGGTGGAGGG - Intergenic
1154294655 18:13137625-13137647 AGCCCCCAGGAGAAACAGGAAGG - Intergenic
1156493241 18:37508764-37508786 TTCTAGCTGGGGAAGCAGGAGGG + Intronic
1157394124 18:47327586-47327608 CCCTCCCAGGGGGACCAGGAAGG - Intergenic
1157516004 18:48312000-48312022 ATCTCTCAGGGACAGAAGGAGGG + Intronic
1158344918 18:56506537-56506559 ATCTCCCAGGCAAAAAAGGAGGG - Intergenic
1158387341 18:57010108-57010130 AACTCCATGTGGAAGCAGGAGGG + Intronic
1158688229 18:59634242-59634264 CTCTGCAAGGGGAAGCAGCAGGG + Intronic
1160611208 18:80086799-80086821 ATCTTCTAGGAGAAGCAGGATGG - Intronic
1160898803 19:1416448-1416470 CTTTCCCAGGGAAAGCAGGCAGG + Intronic
1160954508 19:1684307-1684329 ATCGGCTAAGGGAAGCAGGAAGG + Intergenic
1161359455 19:3839110-3839132 CTCTCCCAGGAAAAGCAGAAGGG + Intronic
1165816378 19:38645006-38645028 CTTTCCCAGGAGAAGCTGGAGGG - Intergenic
1166895243 19:46018497-46018519 AGACCCCAGGGGCAGCAGGAGGG - Exonic
1167522123 19:49961212-49961234 CTTTCACAGGGGAAGCAGCAGGG + Intergenic
1167523258 19:49969513-49969535 CTTTCACAGGGGAAGCAGCAGGG - Intergenic
1167857037 19:52250473-52250495 ATGTCCCAGCTCAAGCAGGAAGG - Intergenic
1168025554 19:53641088-53641110 AGTTCCCAGAGGAAACAGGAGGG + Intergenic
925743018 2:7021538-7021560 AGCCCCCAGGGAAAGGAGGAGGG - Intronic
926779931 2:16461300-16461322 ATGTCCCAGCTCAAGCAGGAAGG + Intergenic
928669668 2:33589028-33589050 AACTCACAGGAGAAGCAGGAAGG + Intronic
930038754 2:47104474-47104496 ATATACCAGAGGAAGCAGAATGG + Intronic
930755588 2:54968850-54968872 CTCTCCCAGGGGCATGAGGAGGG + Intronic
930797629 2:55409677-55409699 CTCTCCCAGTGGAAGCATGTGGG - Intronic
930838917 2:55825003-55825025 AGCTCCCAGAGGTAGCAGGCAGG + Intergenic
930878424 2:56245411-56245433 CTCTGCCAGGGGATGGAGGAGGG + Intronic
932083031 2:68732565-68732587 AGCTCCCTGGGGAGGCTGGAGGG + Intronic
932252780 2:70258720-70258742 GCCTCCCAAGGGAAGCAGGCAGG - Intronic
933909182 2:86924044-86924066 ATCTACCAGCAGAAGAAGGATGG - Intronic
933928772 2:87126624-87126646 ATCTACCAGCAGAAGAAGGATGG - Intergenic
934000105 2:87702409-87702431 ATCTACCAGCAGAAGAAGGATGG - Intergenic
934023542 2:87979341-87979363 ATCTACCAGCAGAAGAAGGATGG + Intergenic
937166221 2:119820454-119820476 ATTACCCAGGGGAAGCAGTGAGG - Intronic
937323073 2:120972491-120972513 ATCACCCAGGAGAATCAGGAAGG - Intronic
937718589 2:125063903-125063925 CTCTCCCAGTGGAAGATGGAAGG + Intergenic
938139903 2:128787005-128787027 ACCTCCCCGGGAGAGCAGGAGGG - Intergenic
939603620 2:144225100-144225122 ATCTCCCAGGTGCAGCAAGTGGG + Intronic
940074212 2:149722433-149722455 AGATCCCAGGAGAAGCAGAAAGG - Intergenic
940901235 2:159128430-159128452 ATCTCCCATGAGAGGCAGAAGGG - Intronic
943351958 2:186806340-186806362 AGCTCCCAGTGGTAGCAGGCAGG - Intergenic
943721372 2:191206507-191206529 ATTTCCCCGAGGAAGCTGGAAGG - Intergenic
945656287 2:212628012-212628034 ATGACCTAGGGGAAGTAGGAAGG + Intergenic
945771144 2:214044668-214044690 CTCTGCCAGGGGATGAAGGAGGG - Intronic
946335208 2:219031276-219031298 AACTCCCAGGTGAAGAAGGTGGG + Exonic
946956881 2:224940605-224940627 ATTTCCCTGGAGAACCAGGAAGG - Intronic
947543093 2:230991781-230991803 CCCTGCCAGGGGCAGCAGGAGGG + Intergenic
948851778 2:240711795-240711817 AGCTCACAGGGGACACAGGAGGG + Intergenic
1168932485 20:1635344-1635366 ACCTGCCAGGTGAAGCATGATGG - Exonic
1169730819 20:8783946-8783968 AGCTCCCAAGGGAAGCATGTGGG + Intronic
1172804025 20:37598395-37598417 TTCTCCCAAGGGAAAAAGGACGG - Intergenic
1173624609 20:44463284-44463306 ATCTCACAGGTGAAGCACGGTGG + Intronic
1173842007 20:46163672-46163694 ATTTCCCAGGGGAAGGGGGGGGG - Intergenic
1175157225 20:56979279-56979301 ATCTCTCAGGGGAGCCAGGGAGG + Intergenic
1177957902 21:27623642-27623664 ATCTCCCAGCTCAAGCAGTAGGG - Intergenic
1178332351 21:31709292-31709314 TTTTCCCAGGGGAAGGAGAAGGG - Intronic
1178827591 21:36029648-36029670 ATGTCACAGAGGAAGCAGGTTGG - Intergenic
1178899685 21:36589015-36589037 ATCTCACAGGGGCAGGAGGCAGG - Intergenic
1179123304 21:38568862-38568884 CTCTTCCAGGTGAAGCAGGCAGG - Intronic
1179930493 21:44568209-44568231 ATCCCCCAGGAGCAGGAGGAGGG - Intronic
1179995463 21:44971951-44971973 ATCTGCCAGTGTGAGCAGGAAGG + Intronic
1181469430 22:23128607-23128629 ATTTCCCAGAGTAACCAGGAGGG - Intronic
1181580596 22:23825943-23825965 ATCTTCCAGGGCAGCCAGGATGG - Intronic
1182301514 22:29339773-29339795 ATCTCCAAGCAGAAGCAGGCAGG + Exonic
1183044713 22:35210642-35210664 GACTCCCAGGGGTGGCAGGATGG + Intergenic
1183325220 22:37187862-37187884 AGGTCCCAGTGGAAGCAGCAAGG - Intronic
1183987377 22:41576966-41576988 ATCGCCCAGGGCAGGCAGGCAGG + Exonic
1184166834 22:42734490-42734512 ATCTCCCAGGGGCTCCAGCAAGG - Intergenic
1184453998 22:44598972-44598994 ACCTCCCTGGGGAAGCAGTGTGG + Intergenic
1184474883 22:44714935-44714957 TTCTTCAAGGGGAAGCAGGGTGG + Intronic
1184704628 22:46202151-46202173 AGCTGCCAGAGGAGGCAGGAGGG - Intronic
1184764276 22:46563594-46563616 GTCTCCCTGGGGCAGCAGGTGGG + Intergenic
1184917936 22:47585979-47586001 CACTCCCAGGGGAAGGAGGCTGG - Intergenic
950135492 3:10577777-10577799 ATCTCCCTGGGGATGCCAGAGGG + Intronic
950218313 3:11175391-11175413 ATATCCCAGGGGAAATGGGATGG + Intronic
950289813 3:11774558-11774580 ACCTCCCAGGGAGAGCAGTAGGG - Intergenic
950376864 3:12579584-12579606 GGCTGCCAGGGGAAGCAGCATGG + Intronic
950424798 3:12919348-12919370 ACCTCCCTTGGGAGGCAGGAAGG - Intronic
953031112 3:39180608-39180630 ATCCCCCAGGGAAGGGAGGATGG + Intergenic
954690020 3:52390807-52390829 ACCTCCAAGGGGATGCAGTAAGG + Intronic
955164048 3:56493136-56493158 ATCTACCAGGGGAAAGTGGAGGG - Intergenic
955329437 3:58034854-58034876 ACCTCCCAGAGGAAGAAGGCGGG + Intronic
955414588 3:58680383-58680405 TTCTCCCAGGGGCAGCCTGAGGG + Intergenic
955856335 3:63277806-63277828 TTCCCCCAGGGGAAGCAAAAGGG - Intronic
956791430 3:72683133-72683155 ATCTCCCCAGGGAAGGAGGAGGG - Intergenic
957590178 3:82186378-82186400 TCCTCACAGAGGAAGCAGGAGGG - Intergenic
961528696 3:127526261-127526283 ATCTCCTTGGGGCAGCAGGAAGG + Intergenic
962407280 3:135110959-135110981 ATCTTCCCAGGGAAGCAGGGTGG + Intronic
962634716 3:137319040-137319062 ATCTCCCAGAGGAGGCATGGGGG + Intergenic
962959887 3:140301003-140301025 ATGTCCCAGCTCAAGCAGGAAGG + Intronic
964472338 3:157068706-157068728 CTCACACAGGTGAAGCAGGACGG + Intergenic
965966002 3:174490382-174490404 ATTTCCTAGGGGAAGGAGAAAGG + Intronic
967811941 3:193767933-193767955 AGCCCCCAGGGGATGCAGGGGGG + Intergenic
968035614 3:195544940-195544962 CTCAGCGAGGGGAAGCAGGATGG + Intergenic
968232042 3:197009985-197010007 TTCTCACAGGGGACGCAGGCAGG - Intronic
969257243 4:6010801-6010823 ATTTTCCAGGGGAAGGACGATGG - Intergenic
969264213 4:6054600-6054622 AGCTCTGTGGGGAAGCAGGAGGG - Intronic
969351482 4:6600484-6600506 AACTCCCAGGGGAGCCAGGAAGG - Intronic
969429464 4:7145708-7145730 ACCTCCCTCGGGAAGCAGGAGGG + Intergenic
969500425 4:7549342-7549364 ATCTCCCCCGGAAAGCAGGTGGG - Intronic
970789692 4:19842340-19842362 ATTTGCCAGGAGCAGCAGGAGGG + Intergenic
975432737 4:74314212-74314234 ATCTCCCTGTGGAATCAGGCTGG - Intronic
975595614 4:76046297-76046319 AAATACCAGGGGAAGCAGAATGG - Intronic
975622588 4:76308691-76308713 TTCTCCCAGGGGAGGCATGCAGG - Intronic
975990356 4:80253428-80253450 ATCTCCAAGGGGGAGAAAGAGGG + Intergenic
977000438 4:91492136-91492158 ATCTCCTACAGGAAGTAGGATGG + Intronic
977622890 4:99156925-99156947 ATCACCCAGGAGAACCAGCATGG - Intronic
979268608 4:118732689-118732711 ATTTCCCAGAGGAGGCTGGAAGG - Intronic
979783143 4:124681416-124681438 ATGTCCCAGGCAAACCAGGATGG - Intronic
983893091 4:173051432-173051454 ATGTCCTAGAGGAAGCAGCAGGG + Intergenic
983954426 4:173680458-173680480 ATGTCCCAGGCGTAGCAGGTTGG + Intergenic
984269540 4:177534202-177534224 ACCTCTCTGGAGAAGCAGGAGGG + Intergenic
984612723 4:181858657-181858679 ATATGCCAGGGGATGGAGGAGGG + Intergenic
985832035 5:2240884-2240906 CTCTCCCGGCAGAAGCAGGAGGG - Intergenic
985906661 5:2843050-2843072 ATCTCCATGGGGGAGCATGATGG - Intergenic
986681001 5:10232748-10232770 ATGGCCCAGGGGAGGCTGGAGGG + Intronic
986963821 5:13246120-13246142 ATCACACAGGGCAAGCAGTAAGG + Intergenic
987237187 5:15954602-15954624 CTCTCCTTGGGGAAGCAAGAAGG - Intergenic
989207584 5:38826889-38826911 GTCCTCCAGGGGAAGAAGGAAGG - Intergenic
989405533 5:41056923-41056945 AGTTCCCAGGAGGAGCAGGACGG - Intronic
989466412 5:41760915-41760937 CTTTCCCAGGGGAAGCAGGTGGG + Intronic
989543114 5:42641124-42641146 GTCTATCAGGGGAAGGAGGAAGG - Intronic
990256757 5:53978495-53978517 ATATCACAGGGCAAGCATGATGG + Intronic
990944764 5:61238362-61238384 ATCTCCTAGCTGAATCAGGATGG + Intergenic
990985875 5:61640298-61640320 ATGACCCAGGGGTAGCAGGCGGG + Intronic
992733658 5:79697280-79697302 AACTCCCAGGGGAATGAGCAAGG - Intronic
993634480 5:90326941-90326963 AGCTCCCAGAAGAAGCAGGGAGG - Intergenic
995986527 5:118182378-118182400 ATCTGACTGGGGAAGCAGGCTGG - Intergenic
996089432 5:119336330-119336352 ATCCCCCAGGGCAGGCAGGGTGG - Intronic
997239722 5:132297390-132297412 AAGTACCAGGGTAAGCAGGATGG + Intronic
997673234 5:135693742-135693764 ATCTGCCATGGGAAAAAGGAGGG + Intergenic
998617897 5:143761031-143761053 GCTTCCCAGGGGAGGCAGGAAGG + Intergenic
999254772 5:150204177-150204199 ATCTCCCAAGGGAGGCAGTTTGG + Intronic
1000068935 5:157721116-157721138 ACCTCACATGGGAAGCAGAAGGG + Intergenic
1000698832 5:164422464-164422486 AGCTCCCAGAGGGAGCAGGCAGG - Intergenic
1001080510 5:168663945-168663967 CTTTCCCATGAGAAGCAGGATGG + Intronic
1001297105 5:170505765-170505787 AGCTCCCAGGGGCATCAGGCTGG + Intronic
1001333317 5:170777546-170777568 CTCTCTCAGGGGTTGCAGGAAGG - Intronic
1001953292 5:175830846-175830868 ACCTGCCAAGGGAAGCAGGTGGG + Intronic
1002351763 5:178588947-178588969 CTATCCCAGGAGAAGGAGGAAGG + Intronic
1003895141 6:10600523-10600545 GGCTCCCAGGGGCAGCATGAGGG - Intronic
1006114388 6:31767490-31767512 GTCTCCCAGGGCCAGGAGGAAGG - Exonic
1006407874 6:33855788-33855810 AAGCCCCAGGGGAATCAGGAAGG + Intergenic
1006719398 6:36140334-36140356 ATCTCCCAAAGGGAGCAGAACGG - Intronic
1006898842 6:37487041-37487063 ATTTCCCAGGAGAAGGAGGGTGG - Intronic
1007636061 6:43300495-43300517 TTCTCCCATGGGTGGCAGGAGGG - Intronic
1009508168 6:64512477-64512499 ATGGCCCAGGGGAAGGGGGAGGG + Intronic
1012121549 6:95373679-95373701 GTCTCCCAGGTCAAGCAGGCAGG - Intergenic
1016387435 6:143542218-143542240 CTCTCCCTGGGGGAGAAGGAAGG - Intronic
1017940770 6:159050940-159050962 TCCTGCCAGGGGAAGCAGTAAGG + Intergenic
1018383884 6:163285318-163285340 ATGTGTCAGGGGAAGCGGGAGGG - Intronic
1019629706 7:2041979-2042001 AGCTCCCTGGGAAAGCAGCAAGG + Intronic
1020073282 7:5241348-5241370 ATGTCCCCGGGGAAGGAGGGTGG + Intergenic
1020105602 7:5421012-5421034 ATCTCCCTGGGAAGACAGGAGGG + Intronic
1020738006 7:11976200-11976222 ATCTACTATGGGAAGGAGGAAGG - Intergenic
1022216930 7:28272551-28272573 CTCCCCCAGAGGAAGGAGGAAGG - Intergenic
1022529531 7:31058182-31058204 TTCAGCCAGGGGAAGCAGAAGGG + Intronic
1024005632 7:45223487-45223509 TTCTAACAGGGGAAGCAGGCAGG - Intergenic
1024220294 7:47281788-47281810 ATCTTCCAAGGGCAGCAGGGAGG + Intronic
1024604827 7:51014641-51014663 ATATCCGAGGGGAAGCAGCAGGG - Intergenic
1025094532 7:56087129-56087151 AGCTGACAGGGGAATCAGGAGGG + Intronic
1027278817 7:76590754-76590776 AGCTCCCAGGGGTAACAGGCAGG + Intergenic
1029883057 7:103837149-103837171 ATATGCCAGGGGAAGAATGATGG - Intronic
1031054989 7:116983524-116983546 ATCCCCTAGGGGAAGGGGGATGG - Intronic
1032238272 7:130142284-130142306 TCCTCCCAGGGGGAGCAGGGTGG - Intergenic
1032476220 7:132213229-132213251 ATGTCTAAGGGGAGGCAGGATGG + Intronic
1033257830 7:139817269-139817291 AGCTCACATGGGAAGCAGGGTGG - Intronic
1034165422 7:149021704-149021726 ATGTCCCAGGGGAAGTTGGAGGG + Intronic
1034943799 7:155249205-155249227 ATCTACCAGCTGAAGAAGGAGGG - Intergenic
1036748552 8:11428243-11428265 ATCTCTGTGGGGTAGCAGGAAGG + Intronic
1037745987 8:21644450-21644472 ATCTTCCAGGTGAACCAGGCTGG + Intergenic
1038019451 8:23540809-23540831 ACCTGCCAGGGGAGGCAGGATGG - Intronic
1038776092 8:30532002-30532024 ATTTCCCTGGTGAAGCTGGAGGG + Intronic
1040902271 8:52428968-52428990 ACCTCTTAGGGGACGCAGGAGGG + Intronic
1041789628 8:61678749-61678771 AGATCCAAGGGGAAGGAGGAGGG - Intronic
1042100640 8:65271994-65272016 ATCTCCCAGTGGGAGAAGAACGG + Intergenic
1045185759 8:99836426-99836448 AGCTACCAGGGGATGGAGGAGGG - Intronic
1045937461 8:107697347-107697369 AAGTCCCAGGAGAAGCAGGTTGG - Intergenic
1047327179 8:123851124-123851146 ATTTCCCCGGGGGAGCAGGAGGG + Intergenic
1049133407 8:140870903-140870925 GTCCCCTAGGGGAAACAGGAAGG - Intronic
1049160788 8:141096248-141096270 AAGTCCCAGGGGCAGGAGGAGGG + Intergenic
1049291460 8:141805140-141805162 GTATCCTAGGGGAAGGAGGATGG + Intergenic
1049472802 8:142783798-142783820 GGGTCCCAGGGGAGGCAGGATGG + Intergenic
1051935456 9:22438436-22438458 AACTACCAGAGGAAGCAGAATGG + Intergenic
1056773279 9:89495184-89495206 ATGCCCCAGGGGAAGCAGCAAGG + Intronic
1057303290 9:93898748-93898770 CTCTTCTAGGGGAAGAAGGAGGG + Intergenic
1057548956 9:96038221-96038243 ATCAGGCAGGGGAGGCAGGAAGG + Intergenic
1057890796 9:98868245-98868267 ATCCCCCAGGAAAAGCATGAAGG - Intergenic
1059140259 9:111846424-111846446 ATCTGCCAGGGGAACCCAGAAGG + Intergenic
1059507120 9:114809461-114809483 ATCATCCAGGAGAGGCAGGATGG + Intergenic
1061679886 9:132237781-132237803 ACCTCCCAGGGGAGCCGGGATGG - Intronic
1062057323 9:134475350-134475372 AGATTCCCGGGGAAGCAGGAGGG + Intergenic
1062057337 9:134475388-134475410 AGATCCCCGGGGAAGGAGGAGGG + Intergenic
1062158133 9:135065468-135065490 TTCCCCAAGGGGAAGCAGGATGG - Intergenic
1062261409 9:135664960-135664982 CTGGCCCAGGGGAAGCAGGGAGG + Intronic
1187941938 X:24391166-24391188 TGCTCCCAGGGGAGGCAGGGAGG + Intergenic
1188515387 X:30980366-30980388 TTCTCCCAAGGCAGGCAGGAAGG - Intergenic
1192310831 X:70012894-70012916 AGCTCCCAGTGGAAGCAGGCAGG + Intronic
1192576251 X:72245594-72245616 ATCTCCCAGGGGAAGCAGGAAGG + Intronic
1193413662 X:81196238-81196260 ATCTGCCAGAGGAGGCAGGAAGG + Intronic
1195704126 X:107726192-107726214 CTCTCCAAGGGGGAGTAGGAGGG + Intronic
1196797096 X:119511080-119511102 CTCTCCCCTGGGAAGCAGCAAGG - Intergenic
1197401604 X:125998699-125998721 GTCTACCAGGAGAAGGAGGAAGG + Intergenic
1197423960 X:126272710-126272732 AGTTCCCAGAGGAAGGAGGAGGG - Intergenic
1197723297 X:129759394-129759416 ATATCCCCGGGGAAGCAGCAGGG - Intronic
1200138124 X:153884836-153884858 AGCCCCCAGGGGAAGAAGGGCGG + Intronic
1200139007 X:153888332-153888354 AAGTCCCAGGAGAAGCAGGAGGG + Intronic
1201345947 Y:12984904-12984926 TTCTCTCATGGGGAGCAGGAGGG - Intergenic