ID: 1192577906

View in Genome Browser
Species Human (GRCh38)
Location X:72257646-72257668
Sequence TTGAAGATGATCAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 336}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192577906 Original CRISPR TTGAAGATGATCAAGGAGGA AGG Intronic
900898040 1:5497529-5497551 TTGAGGATGTCCAAGGAGGCTGG - Intergenic
901038380 1:6349789-6349811 CTGAAGATGATCGAGGAGGCAGG - Exonic
902005520 1:13228915-13228937 TGGAAGTTGATAAAGGAGGTGGG - Intergenic
905328792 1:37177357-37177379 TGGAAGAACATCCAGGAGGAGGG + Intergenic
905949023 1:41930041-41930063 TTGAAGATGATGAGGAAGAAGGG - Intronic
907052221 1:51337250-51337272 TTGGAGGTGAGCAAGGAGGCTGG - Intronic
909066548 1:70941914-70941936 TTGAGGATTTTTAAGGAGGACGG - Intronic
909270169 1:73613835-73613857 TTGATGATGATCAATGATGTTGG + Intergenic
910428474 1:87138815-87138837 TTCAAGATGGCCAAGGCGGAGGG + Intronic
911057944 1:93723734-93723756 TTGAATTTGATCTAGGAGGCAGG + Intronic
912522583 1:110255951-110255973 TAGAAGCTGCTCAGGGAGGAAGG + Intronic
913440242 1:118889366-118889388 TTGTAAATGATCAAAGAGGATGG - Intronic
916268333 1:162914912-162914934 TAGAAGATGTTGGAGGAGGATGG + Intergenic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917246424 1:173006142-173006164 TCCAAGATAATCAAAGAGGAGGG - Intergenic
918043004 1:180924512-180924534 TTGAAGGTGTTGAAGGAGGTGGG + Intronic
918379686 1:183941433-183941455 TAGAAGTTGTTCACGGAGGACGG - Intronic
918960469 1:191269947-191269969 TTAAAGATGATCAAATATGAAGG + Intergenic
919112216 1:193235280-193235302 TTGGAGAAGAGAAAGGAGGAAGG - Intronic
919887449 1:201945314-201945336 TTGAAGATAGTCATAGAGGAGGG - Intronic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920193795 1:204212876-204212898 TTGAAGAACAACAAGGAGGTGGG - Intronic
922075546 1:222240122-222240144 TTGGAGGTGAGCAAGGAGAATGG - Intergenic
922584892 1:226726339-226726361 ATGATGATGATGAAGGAGAAAGG + Intronic
923632026 1:235656666-235656688 TTAAAAATGATCAAGAAGGACGG + Intergenic
923764752 1:236882687-236882709 TTCAAGATGGTGAAGGAGGCCGG - Intronic
1063173793 10:3533759-3533781 ATGAAGAGGATCAGGGAGGGAGG - Intergenic
1063173812 10:3533829-3533851 ATGAAGAGGATCAGGGAGGGCGG - Intergenic
1063788613 10:9413605-9413627 TTCAAGATGATAAATGAGCATGG - Intergenic
1066549632 10:36542323-36542345 TTGAAGATTTTTAAGGAGGAGGG + Intergenic
1068238781 10:54275695-54275717 TTGAAGAGGATAAAAGAGCAAGG + Intronic
1068749876 10:60580208-60580230 ATCAAGATAATCAATGAGGATGG + Intronic
1069265692 10:66454770-66454792 ATGAAGATGAAGGAGGAGGAAGG + Intronic
1069300961 10:66906823-66906845 TTCAAGATGATCCATGAGGGTGG + Intronic
1069621093 10:69837696-69837718 TGGAGGATGATGAAGCAGGAGGG - Intronic
1069679664 10:70274934-70274956 TGGCAGAGGATCTAGGAGGAAGG + Intronic
1071427446 10:85573120-85573142 TTCAAGAAGATCAAAGAGCAAGG - Intergenic
1072160557 10:92762290-92762312 TTGAAGAAGTTGAAGCAGGAAGG - Intergenic
1074235310 10:111578894-111578916 TTGAAGATGTTCATGAAGCAGGG + Intergenic
1074388452 10:113036277-113036299 TGGAAGATTCTCAAGGATGAAGG + Intronic
1074835227 10:117285420-117285442 TTGAAGCTTATCAAGCAGGCTGG - Exonic
1075025666 10:118981396-118981418 TTGAAGATGACCAAGGTGGCCGG + Intergenic
1075204837 10:120437853-120437875 CTGAACATGATGAAAGAGGAAGG - Intergenic
1076089563 10:127670475-127670497 CTGAAGTTGATTAAGGAGAAAGG + Intergenic
1076266305 10:129112120-129112142 TTTAAGAGGATCTAGAAGGAGGG + Intergenic
1077010213 11:376270-376292 ATGAAGATGGACAAGGAGGAGGG + Exonic
1078410004 11:11106793-11106815 TTGAGGATAATAAAGAAGGAAGG + Intergenic
1080771316 11:35344758-35344780 TTGAAGCTGAGAAAGCAGGAAGG - Intronic
1080940083 11:36906564-36906586 TTCAATATGATAAAGGAGCATGG - Intergenic
1081030019 11:38068132-38068154 TTGAAAAGGATCAAGGAGATTGG - Intergenic
1081800921 11:45858803-45858825 ATGAAGATGGCCAAGGAGGCTGG + Exonic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082805432 11:57446395-57446417 CTGAAGATGAACAGGGAGGCAGG + Intergenic
1083090655 11:60196316-60196338 TTGAAGAGATTCAAAGAGGAAGG + Intergenic
1083194061 11:61072526-61072548 TGGCAGAAGATCAGGGAGGAGGG - Intergenic
1084694288 11:70744537-70744559 TTGGAAAGGAGCAAGGAGGAGGG - Intronic
1086156516 11:83672471-83672493 TTTAAGAAAATCAAGGAGGCCGG - Intronic
1086311389 11:85539818-85539840 TTGAAGCTGATGAAGGAAAATGG + Intronic
1086478793 11:87210621-87210643 TTCAAGAAAATCAAGGAGGGGGG + Intronic
1086500536 11:87448654-87448676 TTGAATATGATCATGGAGTGTGG + Intergenic
1087761401 11:102107733-102107755 TTGAAAATGATCCAGGATAAGGG + Intergenic
1087941719 11:104105237-104105259 TTGTAGCTGAGCAAGAAGGAGGG + Intronic
1088342572 11:108785480-108785502 TCCAAGAAAATCAAGGAGGAAGG - Intronic
1089267489 11:117275843-117275865 TTCCAGAAGATCAAGAAGGAAGG + Intronic
1089330735 11:117687191-117687213 GTAAAGAAGTTCAAGGAGGAGGG + Intronic
1091003412 11:131930340-131930362 TTGAAAATAAGCATGGAGGAAGG - Intronic
1091511743 12:1134196-1134218 TTTAATATAATCAAGGGGGAGGG - Intronic
1092441878 12:8511727-8511749 TTAAACATGGTCAAGGAGCAAGG + Intronic
1092955068 12:13542256-13542278 TTAAAGATGAACAAGGAGTAAGG + Exonic
1093148732 12:15597480-15597502 ATGAAGATGATCAGGGATGGAGG - Intergenic
1093518141 12:20015614-20015636 TTGAAGAGGATCATGGAGGCAGG + Intergenic
1094492270 12:30968354-30968376 CTGCAGATGAGCTAGGAGGAAGG - Intronic
1094794288 12:33952478-33952500 TTGAAAATGAGTAAGGAAGATGG - Intergenic
1096130307 12:49153803-49153825 CTAAAGATGATTAAGGAGAAGGG + Intergenic
1097286521 12:57881438-57881460 TTAAACATGATCAAGAAGTAAGG - Intergenic
1098472313 12:70859497-70859519 TTGAAGATTCTCAGGGAGGGGGG + Intronic
1101407121 12:104438522-104438544 TTGAACATGGTCGAGGAGGTGGG - Intergenic
1101760525 12:107655012-107655034 GTGACCATGGTCAAGGAGGAGGG - Intronic
1101868306 12:108540669-108540691 TTGAAGAGGAAAAAGGTGGATGG + Intronic
1103076524 12:117987412-117987434 TTCAAGATGGCCAAGAAGGAGGG - Intergenic
1104226859 12:126843475-126843497 TTGAACAAGTTAAAGGAGGAAGG - Intergenic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1106486369 13:30176401-30176423 TTGGAGAGCATCAAGGAAGATGG - Intergenic
1107128092 13:36865967-36865989 TGGAAGATGAACAAGGACCATGG - Intronic
1107376466 13:39809984-39810006 TCGAAGAGGAAGAAGGAGGAGGG - Intergenic
1107471840 13:40698283-40698305 TTCAAAATAATCCAGGAGGAGGG - Intergenic
1107732092 13:43358567-43358589 CTGATGATGATAAAGAAGGACGG - Intronic
1107925000 13:45250459-45250481 CTGAAGATGAACAAGGGTGATGG - Intronic
1110803634 13:79729687-79729709 TTGCAAACAATCAAGGAGGAGGG - Intergenic
1111968033 13:94880920-94880942 ATGGAAATCATCAAGGAGGATGG - Intergenic
1113401100 13:109994131-109994153 CTGAAGATGATGAAGGAGCCAGG + Intergenic
1113833824 13:113315784-113315806 TTGAAGATACTCAGGAAGGAAGG - Intronic
1114413795 14:22525536-22525558 TTACAGATGCTTAAGGAGGATGG + Intergenic
1114492189 14:23109999-23110021 ATGAAGATGAGGAAGGAGGAAGG + Intergenic
1114893664 14:26958602-26958624 TCTAATATGATCAAGGATGAAGG + Intergenic
1116348028 14:43821539-43821561 TTGTAGATGGCCAAGGAGAAAGG - Intergenic
1116980502 14:51165352-51165374 TTGATGATGGCCAAGGAAGAGGG - Intergenic
1117232963 14:53741042-53741064 TTGAAGAAGAAGAAGGAGCAAGG - Intergenic
1117818674 14:59625114-59625136 TTAAAAATGATGAAGAAGGAAGG + Intronic
1117839640 14:59846287-59846309 CTGTAGGTGAGCAAGGAGGAGGG - Intronic
1117927983 14:60805057-60805079 TTGAACATGGCAAAGGAGGAAGG - Intronic
1121146638 14:91589605-91589627 TTGGAAATTATCAACGAGGATGG - Exonic
1124153571 15:27205596-27205618 TTCAAAAAAATCAAGGAGGAAGG - Intronic
1125240898 15:37574508-37574530 TTGAAAGTGAGCAAGGAGTAAGG + Intergenic
1126482759 15:49144272-49144294 TTGAAGGTGAAAAAGGAGAATGG - Exonic
1126498551 15:49319594-49319616 TTGAAGATGAGCACTGAGGAAGG - Exonic
1128378810 15:67096192-67096214 TTGAAAATGATGACGGAAGAAGG + Intronic
1128523565 15:68391399-68391421 TTGAACATGATCTTGGAGGTTGG - Intronic
1128935859 15:71745977-71745999 TTGAAGAAGAACAAGGGGAAAGG + Intronic
1129057835 15:72834516-72834538 TGGCAGAGGATGAAGGAGGAGGG + Intergenic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1130101551 15:80898455-80898477 TTAAAGATGGGAAAGGAGGAAGG + Intronic
1130314937 15:82787130-82787152 TTGAAGATGATCATGAATTAGGG - Exonic
1130536271 15:84787145-84787167 TAGAAGATGCACAAGGAGGCGGG - Intronic
1133713256 16:8421946-8421968 TTACAAATGCTCAAGGAGGAAGG - Intergenic
1135682073 16:24466094-24466116 TGGAAGTGGATCAAGGAAGATGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137850008 16:51732228-51732250 TTGAAGATATTCTAGAAGGAAGG + Intergenic
1138588568 16:57986886-57986908 TTGAAGAGCATGAAGGAGGCCGG - Intronic
1138768424 16:59632177-59632199 TCCAAGATGATTAAGGAGCATGG + Intergenic
1139201574 16:64982746-64982768 TTCAATATGATCAAGCTGGATGG - Intronic
1140269918 16:73456360-73456382 CAGAAGAAGATAAAGGAGGAAGG - Intergenic
1140700749 16:77579453-77579475 TTGCAAATGAGCAAAGAGGAAGG - Intergenic
1143224638 17:5290382-5290404 TTAAGAATAATCAAGGAGGACGG - Intronic
1144771533 17:17762272-17762294 TTGGAGAAGACCCAGGAGGATGG + Intronic
1145048893 17:19643758-19643780 TTTAAGCTGAAAAAGGAGGATGG + Intergenic
1145301211 17:21639575-21639597 TTAACGATGATAAAGGAGGGAGG + Intergenic
1145349091 17:22063727-22063749 TTAACGATGATAAAGGAGGGAGG - Intergenic
1146274179 17:31504735-31504757 TTGAGGATAAACAAGGAGGATGG - Intronic
1146565666 17:33910853-33910875 TTGAAGTAGATCTAGAAGGATGG + Intronic
1148153422 17:45409794-45409816 ATGAACAGGAGCAAGGAGGAGGG - Intronic
1150961166 17:69913960-69913982 ATGATGATGATGCAGGAGGATGG + Intergenic
1152803468 17:82343005-82343027 TGGGAGATGATCAAGGGTGAGGG + Intergenic
1155676623 18:28437365-28437387 TTCAAAAACATCAAGGAGGAGGG - Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1155923438 18:31628924-31628946 TTGAAGATGGAAAAGGAGGCAGG - Intronic
1156034299 18:32749624-32749646 TTCAACATAATCCAGGAGGAAGG + Intronic
1157112616 18:44835094-44835116 TTGAAGAGTATTAAGGATGAGGG + Intronic
1157127027 18:44966245-44966267 TTGAAGATGATCAGGAAACAAGG - Intronic
1157489685 18:48114047-48114069 ATGAAGATGACCACGGTGGAGGG - Intronic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1158180829 18:54713288-54713310 TTCAAGGTGATACAGGAGGAGGG - Intergenic
1158209056 18:55025798-55025820 GTGAAGAAGATGAAGGAGAAGGG - Intergenic
1158483369 18:57842773-57842795 ATGAAGATGCTCAGGGAAGAAGG - Intergenic
1159680079 18:71338472-71338494 TTGAAGAGCAGCAAGGAGGTCGG - Intergenic
1159698434 18:71591282-71591304 TTGAAGATGCTTGAGGTGGAAGG + Intergenic
1159810386 18:73012134-73012156 TTCAAGATGATCAAGAATCATGG + Intergenic
1160275852 18:77434809-77434831 AGGAAGATGATGAAGGATGAAGG - Intergenic
1160439405 18:78877642-78877664 ATTATGATGATCGAGGAGGAAGG + Intergenic
1161558714 19:4958655-4958677 TTTAAAAAGATCAAGGTGGAAGG - Intronic
1163060477 19:14757427-14757449 TTGAAGAAGAACAAGAAGGTTGG + Intronic
1164073219 19:21788533-21788555 TTTATCATGATCAAGGAGCATGG - Intergenic
1165832631 19:38736971-38736993 CTGAAGAGGATCGGGGAGGAGGG - Intronic
925335248 2:3094283-3094305 TTGAAAATGATCATGTAGTAAGG + Intergenic
926543967 2:14215777-14215799 TTGAAGATGTTTAAGGAGGGAGG - Intergenic
927291428 2:21408540-21408562 TTGAAGATGAGGGTGGAGGAAGG + Intergenic
931373746 2:61688866-61688888 TTGATAATGCTCCAGGAGGAGGG + Intergenic
932064679 2:68541842-68541864 TTGAAGATGATCAAAGTTGGAGG + Intronic
932470968 2:71956900-71956922 TTCAAAAAAATCAAGGAGGAAGG + Intergenic
932911207 2:75807897-75807919 TTGAAGAAGAGAAAGGAGGGTGG + Intergenic
935126908 2:100232325-100232347 CAGAAGATGATTAAGGAGTAAGG - Intergenic
937621085 2:123987029-123987051 TTGAAGATTATCAACTGGGAAGG - Intergenic
939121811 2:138126433-138126455 TTAAAAATGATAAAAGAGGAAGG + Intergenic
939367447 2:141251402-141251424 TTGTGGATAATAAAGGAGGAGGG + Intronic
939445403 2:142303699-142303721 TTGAAGATAATCCAGGAGACAGG + Intergenic
939514942 2:143154670-143154692 TTGAAGAGGATTATGGATGAGGG + Intronic
939603650 2:144225300-144225322 TTGAAGATGATAAGGGAGGCTGG - Intronic
939946130 2:148413390-148413412 TTGAAGTTCATCAAGGAGATTGG + Intronic
940817583 2:158312814-158312836 GTGAAGAGGATGAAAGAGGATGG + Intronic
941293080 2:163700372-163700394 TTGAAGAAGAGAAAGAAGGAAGG + Intronic
941412031 2:165170146-165170168 TTGAAGCTGATAAAGGTGTAAGG + Intronic
941575677 2:167226994-167227016 TGGAGCATGATCAAGGAGCAGGG + Intronic
942775328 2:179574865-179574887 TTTAAGAAGTTCAAGAAGGAAGG - Intronic
943104506 2:183527908-183527930 GAGAAGATCATCAAGAAGGAAGG + Intergenic
943151713 2:184122197-184122219 TTGGAGATGTTTAAGGATGATGG - Intergenic
945250869 2:207765882-207765904 TTTAACATGATAAAGGGGGAGGG + Exonic
945472486 2:210242800-210242822 TTAGGGATGAGCAAGGAGGAGGG - Intergenic
945488643 2:210428134-210428156 TTGATGATGAGCAAGGTGGAGGG - Intergenic
945708977 2:213272666-213272688 TTGAAGCTGATCAGAGTGGAAGG - Intergenic
948759360 2:240181064-240181086 TTGAAGGTGATCAAGGAGGGTGG - Intergenic
1169887382 20:10415360-10415382 TTGAAGATGTGCAAAGAGGTGGG + Intronic
1170717470 20:18844414-18844436 TAGGGGATGACCAAGGAGGAGGG + Intergenic
1171790541 20:29519102-29519124 TTGAAGATGCTGAAGAAGCAAGG - Intergenic
1171857168 20:30357733-30357755 TTGAAGATGCTGAAGAAGCAAGG + Intergenic
1172203111 20:33140552-33140574 TTCATGATGGTCAAGGAGGGGGG + Intergenic
1172357081 20:34287717-34287739 GAGAAGATGAACAAGGAGAAGGG + Intronic
1174200299 20:48802379-48802401 TTCAGGATCATCAAGGAGGCTGG - Intronic
1174985632 20:55448531-55448553 TTGAAGTTGGTCAAGTAGGGAGG - Intergenic
1175303749 20:57961474-57961496 TTGGAGATCAGCAGGGAGGAGGG - Intergenic
1175660263 20:60806548-60806570 TCGAAGAACGTCAAGGAGGAAGG + Intergenic
1175956200 20:62610645-62610667 ATGAAGATGAGCAAGAAGGCAGG + Intergenic
1176349381 21:5779780-5779802 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176356195 21:5900364-5900386 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176543702 21:8177850-8177872 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1176562653 21:8360895-8360917 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1177202541 21:17973893-17973915 CTTAAGCTGAGCAAGGAGGAAGG - Intronic
1177668155 21:24188718-24188740 TTGAACATGAACAAGCATGAGGG - Intergenic
1178229235 21:30762050-30762072 TTGGACATGATGAAAGAGGAAGG - Intergenic
1178810031 21:35873065-35873087 TAGAAAATGAGCAAGGAGGCTGG + Intronic
1179003979 21:37493448-37493470 TTAAAGATGATAAAGAATGAAGG + Intronic
1179072885 21:38089482-38089504 TTGAAGATGAAGATGGAGGAAGG + Intronic
1181654491 22:24284987-24285009 TTGAAGAGGAAGATGGAGGAAGG + Intronic
1182028513 22:27138772-27138794 TTGCAGAGGTTCAAGGTGGAGGG + Intergenic
1182658794 22:31910509-31910531 TGGAGGATGATGGAGGAGGAAGG - Intergenic
1183551174 22:38486680-38486702 TTGAGGATGATCAAGAAACACGG + Intronic
1183878085 22:40801667-40801689 CTGAAGATGAGCAAGGATGCTGG - Intronic
1185131124 22:49039418-49039440 GTGAAGATGATAAAGGAAGCAGG - Intergenic
1203248570 22_KI270733v1_random:94072-94094 TTGCAGAGGATGATGGAGGAAGG - Intergenic
950205455 3:11076804-11076826 CTGAAGCAGATCAGGGAGGAAGG - Intergenic
950731192 3:14959702-14959724 TTTAAGATGATCCAGGAAGTTGG + Intronic
951870972 3:27362141-27362163 TTGAAGAAGGTCCAGAAGGATGG + Intronic
952064448 3:29551310-29551332 TTGAAGATGATCAGGAAACATGG + Intronic
954901454 3:54023608-54023630 TTAAAAATAATCCAGGAGGAGGG - Intergenic
956282468 3:67572075-67572097 TGGAAGATGATCATAAAGGAAGG - Intronic
956976989 3:74592243-74592265 TGGAAGATGATCAATGAGAGAGG + Intergenic
957700475 3:83704044-83704066 TTTAAGAAGATCAAAGAGAATGG + Intergenic
957849259 3:85784821-85784843 TTCAAAAAAATCAAGGAGGAGGG - Intronic
958962426 3:100522852-100522874 TTGAAGATGATCCTAGAGGGTGG + Intronic
960227733 3:115186488-115186510 CTGAAGATGACAAAGGGGGAAGG - Intergenic
960409238 3:117301897-117301919 TTGAAGATCATCCAGGACTACGG - Intergenic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
962088075 3:132212840-132212862 TGGAAGATGATCCAGGAAGGAGG - Intronic
962473918 3:135739379-135739401 TTGAAGTTGATCCAGAAGGGAGG - Intergenic
963018261 3:140846443-140846465 CTGAAGATGATCAAAGAGATAGG + Intergenic
965017874 3:163182830-163182852 ATGAAGATGATGAAGGAAGAAGG - Intergenic
965942037 3:174195992-174196014 TTGATGAGGATAAAGCAGGAGGG + Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967442305 3:189522809-189522831 TTCCAGAACATCAAGGAGGAGGG + Intergenic
967526922 3:190505952-190505974 TTTATGGTGACCAAGGAGGAAGG - Intergenic
967668956 3:192209316-192209338 ATGAAAATTATCAATGAGGATGG + Intronic
967708221 3:192677185-192677207 TGGAAGGTGAGGAAGGAGGAAGG - Intronic
969238462 4:5884345-5884367 GTGAAGATGATCAGGAAAGAAGG - Intronic
970760141 4:19475832-19475854 TTGAAAAACAGCAAGGAGGACGG + Intergenic
971255382 4:25009261-25009283 TTGAAGAACATCCAGGGGGATGG - Intronic
971282385 4:25251488-25251510 TTTAAGCTGGCCAAGGAGGAGGG + Intronic
972539136 4:40023944-40023966 GTGAAGAAGATGAAGTAGGAAGG + Intergenic
972541632 4:40044019-40044041 CTGAAGATGATCAAAGAGGCGGG - Intergenic
976015332 4:80545701-80545723 TTGCAAAAAATCAAGGAGGAGGG + Intronic
976406966 4:84670856-84670878 TTGAAGATGGTGATGGGGGAGGG + Exonic
976492691 4:85690344-85690366 TTCAAAAATATCAAGGAGGAGGG - Intronic
979041283 4:115799922-115799944 TTGGATAAGATCAAGGAAGAAGG - Intergenic
979507111 4:121510873-121510895 TTAAAAATAATCAAGGAGGTGGG + Intergenic
979513665 4:121582752-121582774 TTGAAGATGATGATGGTGCAAGG + Intergenic
980255519 4:130376022-130376044 TTGAAGGTGGTAAATGAGGAAGG + Intergenic
980684871 4:136214226-136214248 TTTGAGATGATCAAGCAGTAAGG + Intergenic
981826514 4:148948211-148948233 TTGAAGATGAATTAGGGGGAGGG + Intergenic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
985052860 4:186010207-186010229 ATGAAGATCATCAAGGGAGAAGG + Intergenic
985104141 4:186485088-186485110 TTAAAGGTGATAAAGGGGGACGG + Intronic
986776105 5:11015441-11015463 TTGAAGAGATTCAAGAAGGATGG - Intronic
987558664 5:19489043-19489065 TTTAAGATTATCAAGTAGGAAGG - Intronic
988901852 5:35741426-35741448 TTGAAGAACAGCAAGGAGGCTGG + Intronic
989773811 5:45178350-45178372 TTGAAAATGATCAATAAGCAAGG - Intergenic
990155806 5:52876053-52876075 GTGAAAATCCTCAAGGAGGAAGG - Intronic
990516916 5:56539023-56539045 TTGATGATGAGAAAGGATGAAGG + Intronic
991055531 5:62315633-62315655 ATGAAGAAGATAAGGGAGGAGGG + Intronic
992417613 5:76566821-76566843 TGGGAGATGACCAAGGAGGAGGG + Intronic
993334392 5:86639550-86639572 TAGAAGATGATATAGGAGGTAGG + Intergenic
995022943 5:107386238-107386260 TTTGAGATGATCAAGGGAGATGG + Intronic
995458716 5:112379601-112379623 TTGCAGATGAGAAAGCAGGAGGG - Intronic
996141871 5:119921185-119921207 TTCCAAAAGATCAAGGAGGAGGG - Intergenic
996763834 5:127015361-127015383 GGGAAGATGAGCAGGGAGGAGGG + Intronic
997347119 5:133200042-133200064 TTGGAAATGATTATGGAGGAAGG + Intronic
998725721 5:145011619-145011641 ATGATGATGACCAAGGAAGAAGG - Intergenic
999908413 5:156169128-156169150 TTGCAGATAATCAAGGAGCCTGG - Intronic
999966896 5:156819833-156819855 TTGAGGATGGGCATGGAGGAAGG + Intergenic
1001689088 5:173618998-173619020 GTGAAGATGATCAAGCTGAAGGG + Intergenic
1002624479 5:180515601-180515623 TTGAAGTTGAGAAATGAGGAGGG + Intronic
1002883302 6:1271896-1271918 TTCAAAATGAGGAAGGAGGAGGG - Intergenic
1004603907 6:17176181-17176203 CTGAAGATGGTCAAGGAGAGGGG + Intergenic
1004801335 6:19152161-19152183 CTGAAGATGATCTTGAAGGAGGG + Intergenic
1006050168 6:31336070-31336092 TTTTAGATGACAAAGGAGGATGG + Intronic
1006505523 6:34486375-34486397 TTGAAGATGAGAAAACAGGAAGG + Intronic
1006732647 6:36247664-36247686 TAGAGGAGGGTCAAGGAGGAAGG + Intronic
1008383638 6:50861919-50861941 TATAAAATGATCAGGGAGGAGGG + Intergenic
1008639205 6:53444228-53444250 TTGAGGTTGATGAAGGAGAAAGG - Intergenic
1009849405 6:69176661-69176683 TTGCAAAAAATCAAGGAGGAAGG - Intronic
1010863754 6:80946829-80946851 TTGAAGTAGATAAATGAGGAAGG - Intergenic
1011430583 6:87282186-87282208 TTGAAGATGTTTAAATAGGAAGG - Intergenic
1012161951 6:95896724-95896746 TTGAAGAAGATAAAGTACGAAGG - Intergenic
1012171152 6:96017447-96017469 ATGAATATGAGCAAGGGGGATGG + Intronic
1012608088 6:101182908-101182930 TGGCAGAAGATCTAGGAGGACGG + Intergenic
1013105990 6:107027306-107027328 TTGGAGATGTTCAAAGAGGGCGG + Intergenic
1014463332 6:121725631-121725653 TTGTAGATTATTAAGGAGGCAGG + Intergenic
1015809738 6:137149797-137149819 TTGAAGAAGAGCATGCAGGAAGG - Intronic
1017777245 6:157689748-157689770 CTGAAGGTGATCAAGGACCAAGG + Intergenic
1018878829 6:167853880-167853902 TTGAAAATGATCCAGCAGTAGGG - Intronic
1019320699 7:414186-414208 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1019320733 7:414264-414286 AGGGAGAGGATCAAGGAGGAGGG - Intergenic
1021847432 7:24776450-24776472 TTGATAATTATCGAGGAGGATGG - Intergenic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022349251 7:29551555-29551577 GAGAAGAGGATGAAGGAGGAGGG + Intergenic
1022873858 7:34507559-34507581 TTGAAAATGATCAAGTAAGAGGG + Intergenic
1023298375 7:38740528-38740550 TTGCAGATGACCCAGGAGAAAGG - Intronic
1023416224 7:39935508-39935530 TTGCAGAGGTTCAGGGAGGAAGG - Intergenic
1023792226 7:43762114-43762136 TTGAGGAGGAACAAGGAGGAAGG + Intronic
1024192724 7:47029182-47029204 TGGAAGAGGATAAAGAAGGAGGG + Intergenic
1024377674 7:48657607-48657629 TTGAAGATGAGATAGGAGTAGGG + Intergenic
1024651969 7:51411062-51411084 TTCCAGAAAATCAAGGAGGAGGG + Intergenic
1025209512 7:57012889-57012911 TTCATGAGGATCAGGGAGGATGG - Intergenic
1025662436 7:63563961-63563983 TTCATGAGGATCAGGGAGGATGG + Intergenic
1028246840 7:88489607-88489629 AAGAAGAAGAACAAGGAGGATGG - Intergenic
1028304895 7:89250547-89250569 TTCCAGAAAATCAAGGAGGAGGG + Intronic
1030886186 7:114940862-114940884 GTAAAGATTATCAAGGAAGATGG - Intronic
1031465717 7:122108279-122108301 TTCCAGAATATCAAGGAGGAGGG + Intronic
1032658839 7:133961170-133961192 TTGAAGATGAGGAAGGAGCCAGG + Intronic
1032790892 7:135241672-135241694 GTGAAAATGTACAAGGAGGAGGG - Intronic
1033157918 7:138972238-138972260 TTGAAGTGGAACATGGAGGAAGG - Intronic
1033395788 7:140972659-140972681 TTGAAGATGATGAATAAAGAAGG + Intergenic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034150948 7:148914952-148914974 ATAAAAATGATCAGGGAGGAGGG - Intergenic
1034225481 7:149477701-149477723 TTGATGCAGATCAAGCAGGAGGG - Exonic
1034503092 7:151464158-151464180 TTGAAGAGTATCAAGGCAGAGGG + Intergenic
1034696077 7:153055053-153055075 TTGGATATGGTGAAGGAGGAGGG + Intergenic
1035848519 8:2890781-2890803 TTGAGGAAGAGCAAGGAGGCAGG + Intergenic
1038001833 8:23398647-23398669 TTGATGATGATAAAGGATGCTGG - Intronic
1038841048 8:31185228-31185250 TGCAAGAGGAACAAGGAGGACGG + Intergenic
1040559131 8:48508468-48508490 TTGGAGATGATAAAGGAGGGTGG + Intergenic
1041991287 8:63995043-63995065 TTGAAGATGAATAAGTATGAAGG + Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042679657 8:71368766-71368788 TTGAAGACTATCAAACAGGAGGG + Intergenic
1045747489 8:105440749-105440771 CTGAAGACCATCAAGAAGGAAGG + Intronic
1045845504 8:106630649-106630671 TAGCAGATGAGCAAAGAGGAAGG + Intronic
1045956529 8:107914640-107914662 TTGAAAATTCTAAAGGAGGAAGG - Intronic
1045988978 8:108283944-108283966 TTGATGAATATGAAGGAGGACGG - Intronic
1046552752 8:115737451-115737473 TTGAAGAAAATCTAGGAGAATGG - Intronic
1048150032 8:131885321-131885343 TAGAAGATGATAAAGGCAGAGGG - Intergenic
1050266467 9:3895692-3895714 ATGAAGATGAACAGGGAAGATGG - Intronic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1051720695 9:20034156-20034178 GTGTAGATAATCAAGCAGGAAGG - Intergenic
1051939098 9:22483272-22483294 TGGAATATGATTAAGGAGTAAGG - Intergenic
1053278753 9:36802813-36802835 ATGAAAAGGATCAGGGAGGAGGG + Intergenic
1054879144 9:70126599-70126621 ATGAAGGTGATAAAGGAGGCAGG - Intronic
1055039552 9:71854695-71854717 ATGAAGAAGATCCAGGAGAATGG + Intergenic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055544582 9:77356156-77356178 ATGAAGAAGAGCAAGGAGGCTGG - Intronic
1056194007 9:84211699-84211721 TTGAACATGAGCAGAGAGGAAGG + Intergenic
1056693823 9:88829768-88829790 GTGGAGATGACCCAGGAGGAAGG + Intergenic
1056849513 9:90070482-90070504 TTGAAGAAGAGCATGGAGGATGG + Intergenic
1056905015 9:90638967-90638989 CTAAAGATGGTAAAGGAGGAAGG + Intronic
1057164799 9:92917048-92917070 TAGAAGGAGATCAAGGAGGAAGG + Intergenic
1058847710 9:108978421-108978443 GTAAAGATGATGAAGGAGGGTGG - Intronic
1060258972 9:122057145-122057167 TTAAAGGTGTTCAGGGAGGATGG + Intronic
1060500908 9:124154316-124154338 TTCCAAAAGATCAAGGAGGAGGG + Intergenic
1060870352 9:127034928-127034950 TGGAAGTTGAACAGGGAGGAAGG - Intronic
1060871096 9:127040711-127040733 TTGAAGTTGCCCAAGGAAGAAGG + Intronic
1203464971 Un_GL000220v1:77320-77342 TTGCAGAGGATGATGGAGGAAGG - Intergenic
1186328688 X:8509104-8509126 GTGAAGATGGTCATGCAGGAAGG - Intergenic
1187824738 X:23323660-23323682 TGGAAGAAGAAGAAGGAGGAGGG - Intergenic
1188119774 X:26290017-26290039 TTCCAGAAAATCAAGGAGGAAGG - Intergenic
1189765954 X:44372427-44372449 CTGAAGGGGATAAAGGAGGAAGG - Intergenic
1189957276 X:46288548-46288570 ATGAAGATCCTCAAGGAGGGCGG - Intergenic
1190487795 X:50945854-50945876 TTGAAGAGGATAATGGAGAAGGG - Intergenic
1191823948 X:65343282-65343304 TTCAAAATAATTAAGGAGGAGGG + Intergenic
1192577906 X:72257646-72257668 TTGAAGATGATCAAGGAGGAAGG + Intronic
1194774957 X:97951823-97951845 TTTAAGAAAATAAAGGAGGAAGG + Intergenic
1195803377 X:108736361-108736383 TTTAAGGTGAGCGAGGAGGAGGG + Exonic
1196218760 X:113087544-113087566 ATGAAGAAGATCATGGCGGATGG + Intergenic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1196765429 X:119237473-119237495 TGGAAGGTGAACAAGGAGGAAGG + Intronic
1197620967 X:128747529-128747551 CAAAAGATGATCAAAGAGGATGG - Intergenic
1197897922 X:131336352-131336374 ATGAAGAAGAACAAGTAGGAAGG - Intronic
1199143641 X:144339331-144339353 TTCAAGATGATTAAGGAGCATGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1201397829 Y:13567627-13567649 TCCAAGATGATTAAGGAGTATGG - Intergenic
1201433604 Y:13931664-13931686 GTGAAGATGGTCATGCAGGAAGG + Intergenic