ID: 1192584529

View in Genome Browser
Species Human (GRCh38)
Location X:72308727-72308749
Sequence ACTAGGCAGGGCCCACAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192584529_1192584534 -3 Left 1192584529 X:72308727-72308749 CCAGATTGTGGGCCCTGCCTAGT No data
Right 1192584534 X:72308747-72308769 AGTCTCCCTCTGATAAAAGGCGG No data
1192584529_1192584538 7 Left 1192584529 X:72308727-72308749 CCAGATTGTGGGCCCTGCCTAGT No data
Right 1192584538 X:72308757-72308779 TGATAAAAGGCGGGATCTGTCGG No data
1192584529_1192584533 -6 Left 1192584529 X:72308727-72308749 CCAGATTGTGGGCCCTGCCTAGT No data
Right 1192584533 X:72308744-72308766 CCTAGTCTCCCTCTGATAAAAGG No data
1192584529_1192584535 -2 Left 1192584529 X:72308727-72308749 CCAGATTGTGGGCCCTGCCTAGT No data
Right 1192584535 X:72308748-72308770 GTCTCCCTCTGATAAAAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192584529 Original CRISPR ACTAGGCAGGGCCCACAATC TGG (reversed) Intergenic