ID: 1192584599

View in Genome Browser
Species Human (GRCh38)
Location X:72309136-72309158
Sequence TTCAATGGTCCGGATGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192584599_1192584607 -10 Left 1192584599 X:72309136-72309158 CCTCCCCCATCCGGACCATTGAA No data
Right 1192584607 X:72309149-72309171 GACCATTGAAGGGCAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192584599 Original CRISPR TTCAATGGTCCGGATGGGGG AGG (reversed) Intergenic
No off target data available for this crispr