ID: 1192587389

View in Genome Browser
Species Human (GRCh38)
Location X:72329744-72329766
Sequence ATTTTTAAGCGAATTGGGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192587389 Original CRISPR ATTTTTAAGCGAATTGGGGA GGG (reversed) Exonic
900748676 1:4379430-4379452 ATTGTTAGGAGAATTGGGGGTGG - Intergenic
907296004 1:53454919-53454941 ATTATTAAGCCATTAGGGGAGGG + Intergenic
909770166 1:79412202-79412224 ATTTTTAGGCAAATAGAGGAAGG + Intergenic
910067160 1:83167714-83167736 ATTTTTAAGCCCATTGGAAAAGG - Intergenic
910996388 1:93108722-93108744 GTTTTTCAGCAAATTTGGGAAGG + Intronic
912045706 1:105452940-105452962 ATATTTAAGCCATTTGGGAAAGG + Intergenic
913667280 1:121059991-121060013 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914018970 1:143847134-143847156 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
914657521 1:149755341-149755363 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
915725182 1:158012091-158012113 TTTTTTAATCTTATTGGGGAAGG - Intronic
919379199 1:196835065-196835087 ATTTTTGACAGAATTTGGGAAGG - Intronic
919604174 1:199660338-199660360 ATGTTGAAGTGAATTGGGGCAGG + Intergenic
920141108 1:203814118-203814140 ATTTCTAAGCAAAGTGTGGAAGG - Intronic
920684692 1:208100539-208100561 ATTTTTAAGAAAATAGGAGAGGG + Intronic
922772377 1:228193026-228193048 ATTTTTAATCTACTTGGGGTTGG + Intergenic
1063819600 10:9819423-9819445 ATTTTTCTGTGAACTGGGGATGG + Intergenic
1064512186 10:16107555-16107577 ACTTTTATGCTAATTGGTGATGG - Intergenic
1064549510 10:16484641-16484663 ATTTTAAAGCTAATGGTGGAGGG + Exonic
1068146339 10:53075785-53075807 GTTTTTAAGAAAATTGTGGAGGG - Intergenic
1068348713 10:55816361-55816383 ATGTTTAAACAAATTGTGGAAGG - Intergenic
1073370342 10:102982800-102982822 ATTTTTAAACTAATTAGTGATGG + Intronic
1074811811 10:117112260-117112282 ATTATTAAGAGAACTGGGGCTGG - Intronic
1075660496 10:124192530-124192552 GTTATTAAGCGAATTAGGGAGGG - Intergenic
1078477683 11:11645713-11645735 CTCTTTAAGCAAATGGGGGATGG - Intergenic
1079235530 11:18686555-18686577 CTGTTTAAGCAAATTGTGGAAGG + Intergenic
1081818577 11:45968615-45968637 ATTTTTAAGAGTATTAGAGAAGG - Intronic
1082170722 11:49001818-49001840 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1082567568 11:54699616-54699638 GTTATTAAGCAAATTAGGGAGGG - Intergenic
1085972966 11:81615937-81615959 AATTTTCAGCAAATTGGGTATGG + Intergenic
1086695083 11:89834542-89834564 ATTTTTAAGGGGATTGTGGAAGG + Intergenic
1086711067 11:90009942-90009964 ATTTTTAAGGGGATTGTGGAAGG - Intergenic
1086812643 11:91329720-91329742 ATTTCCAAGCCAATTAGGGAGGG - Intergenic
1087596509 11:100260902-100260924 ATTTTTAATAGAAATGGTGATGG - Intronic
1087984246 11:104657868-104657890 TTTTATAAGCCAATTGGGGTGGG - Intergenic
1088070115 11:105772581-105772603 ATTTTTAACTGAGTTGGGGGTGG + Intronic
1089133397 11:116230056-116230078 ATGTTTAAGTGAAATGTGGAGGG + Intergenic
1089267272 11:117273719-117273741 AGTTTTAAGGGGATTGTGGAAGG + Intronic
1090540961 11:127704008-127704030 ATTTTGAATAGAATTGGGGATGG + Intergenic
1090945881 11:131429164-131429186 ATTTTTAAGGGATTGAGGGATGG + Intronic
1095281317 12:40354615-40354637 ATATTAAAGGGAATTGTGGAAGG + Intronic
1095434508 12:42172507-42172529 TTTTTTAAGCGACTAGGGCAGGG + Intronic
1097674084 12:62579086-62579108 TTTTTTAAGTTAATTGGGCATGG + Intronic
1098078187 12:66756011-66756033 ATTTTTAAAAGGATGGGGGAAGG - Intronic
1098429945 12:70408167-70408189 ATTTTTCAGCGACTCTGGGAAGG + Intronic
1099057360 12:77860747-77860769 ATTTTAAAGCCAAATGGGCAGGG + Intronic
1099620379 12:84996201-84996223 ATTTTTAAGGGGATTGTGAAGGG - Intergenic
1100326884 12:93548477-93548499 ATTTTTAAAAAAATTGTGGAAGG - Intergenic
1100705265 12:97193967-97193989 ATTTTTAAGGGTTTTGGAGAGGG + Intergenic
1101492816 12:105225137-105225159 TTTTTTAAGTAAATTTGGGATGG - Intronic
1103147777 12:118610430-118610452 ATTTTTAAGGGTATTGGTGTGGG + Intergenic
1107794809 13:44039542-44039564 AATTTTAAAAGAATTGGTGAGGG + Intergenic
1108766240 13:53633243-53633265 ATTTTTAGGCAGATTGGGAAAGG + Intergenic
1110189791 13:72717226-72717248 ATTTCCAAGCAAATTGTGGAAGG - Intronic
1110297264 13:73882830-73882852 ATTTTAAAGCAAATTATGGAAGG + Intronic
1110561981 13:76918793-76918815 GTTATTAAGCTAATTAGGGAGGG + Intergenic
1111445141 13:88338016-88338038 ATTTCTAGGGGAAATGGGGAGGG - Intergenic
1112587389 13:100731316-100731338 ATTTTTAGGTGGATGGGGGATGG + Intergenic
1112945434 13:104921014-104921036 GTTTTTAAGCTAATCAGGGAGGG + Intergenic
1116103259 14:40467731-40467753 AGGTTTAAGCAAATTGTGGAAGG + Intergenic
1116360692 14:43993100-43993122 TTTTTAAAGCAATTTGGGGAAGG - Intergenic
1121683221 14:95811679-95811701 TTTTTTATGTGAATTGGGGATGG + Intergenic
1122567510 14:102671284-102671306 ATTTTTTAGGGTATAGGGGAGGG + Intronic
1123205542 14:106709296-106709318 ATTTCTAAGCAAAGTGTGGATGG + Intergenic
1123482651 15:20647141-20647163 ATTTCTAAGCAAAGTGTGGATGG + Intergenic
1124177524 15:27440142-27440164 ATTTTTGAGAGTGTTGGGGATGG - Intronic
1125108019 15:35996926-35996948 ATTTTTCCGTGAATTGGGGAGGG + Intergenic
1128120232 15:65140648-65140670 ATTTTTAAGGGGGTTGTGGAGGG - Intergenic
1131618035 15:94036928-94036950 ATTTATGAGGGAATTTGGGAGGG - Intergenic
1137250705 16:46738406-46738428 ATTTTTAAATGAGTTGGGCATGG + Intronic
1144607174 17:16677217-16677239 AGTTTTAGGAGAATTGGTGAGGG - Intergenic
1144622601 17:16827787-16827809 ATTTTAAAAAGAAGTGGGGAGGG + Intergenic
1144883828 17:18444923-18444945 ATTTTAAAAAGAAGTGGGGAAGG - Intergenic
1145148404 17:20499454-20499476 ATTTTAAAAAGAAGTGGGGAAGG + Intergenic
1146351560 17:32099418-32099440 ATTTTTAAGCAAATGGAGAATGG - Intergenic
1150590395 17:66557221-66557243 TTTTTTAAGGGCCTTGGGGAAGG + Intronic
1150751609 17:67868708-67868730 ATTTTTAAGCAAATGGAGAATGG - Intronic
1150985379 17:70190724-70190746 ATTTTTAAGGAACTTGGGGAAGG - Intergenic
1153280011 18:3406148-3406170 ATTTTTAAGCGTTTTGGGTTTGG - Intergenic
1153897444 18:9579436-9579458 AATGTTAAGCCATTTGGGGAAGG - Intronic
1155022548 18:21909976-21909998 ATTTTAAAGTGAATGGAGGAGGG - Intergenic
1156708341 18:39911628-39911650 ATTTCTAAGCAAAGTGGTGAAGG + Intergenic
1158437964 18:57447311-57447333 CTGTTTGAGCGAATTGGAGATGG + Intronic
1159038007 18:63295993-63296015 ATTTTGAGGCCCATTGGGGAAGG - Intronic
1164188849 19:22897041-22897063 ATTTTTATGGGAAAGGGGGAAGG + Intergenic
1166017735 19:39995673-39995695 ATTTTTAAGGGATTTGGGGGGGG + Intronic
927500403 2:23579106-23579128 TTTTTTAAGCCATTTGTGGAGGG + Intronic
929848190 2:45555073-45555095 ATTTTTAAGGGGATCGTGGAGGG - Intronic
930450728 2:51534043-51534065 GTTTTTAAGCATATTTGGGAAGG + Intergenic
931110888 2:59110368-59110390 ATTTTCAAGCCCATTTGGGAAGG + Intergenic
931288617 2:60853468-60853490 ATTTTTGTGCAAATTAGGGAAGG + Intergenic
931803069 2:65777689-65777711 ATTATTAAGCTGATTTGGGATGG + Intergenic
934520750 2:95018779-95018801 TTTTTTAAGGGGTTTGGGGAAGG + Intergenic
934922628 2:98358312-98358334 ATATTTCAGCTAATTGAGGAAGG + Intronic
936588888 2:113783929-113783951 ATTTTAAAGAGAATATGGGAAGG - Intergenic
937623811 2:124021680-124021702 ATTTTTGATAGAATAGGGGAGGG + Intergenic
939111799 2:138017413-138017435 ATTTTTAAGAGAATTTTTGATGG - Intergenic
940618571 2:156083085-156083107 ATTATTAAGCTAATCAGGGAGGG - Intergenic
941602178 2:167557181-167557203 ATTATTAAGTGACTTGGAGATGG + Intergenic
942555586 2:177169342-177169364 ATTTTTATGAAAAATGGGGAGGG - Intergenic
944466635 2:200008000-200008022 ATTTTTAAGTGCATGGGGGTTGG + Intronic
944873929 2:203943107-203943129 GTTATTAAGCTAATCGGGGAGGG - Intronic
945197182 2:207247812-207247834 AATTTAAAGCAAAGTGGGGAGGG + Intergenic
946778001 2:223163966-223163988 ATTTTTATGTGTATTGGGGTTGG - Intronic
1170245639 20:14219485-14219507 GTTATTAAGCTAATTGGGGAGGG - Intronic
1170359764 20:15533297-15533319 CTTTTTAAGAGAATTGCAGAAGG + Intronic
1171230230 20:23478648-23478670 ATTTTTAACAGATTTGGAGATGG + Intergenic
1172653562 20:36522807-36522829 ATTTCTAAGGGGGTTGGGGATGG + Intronic
1173975280 20:47182313-47182335 ATTTTTAAGCGTATAGTGCATGG - Intronic
1174947558 20:55005023-55005045 ATTCTTAAGTGAAATGGGGAGGG + Intergenic
1176714050 21:10334720-10334742 ATTTTTCCGCGGAGTGGGGATGG + Intergenic
1178750918 21:35302309-35302331 AGTTCTAAGAAAATTGGGGAAGG - Intronic
1178778458 21:35575561-35575583 ATTTTTAAACAAAGTAGGGAAGG + Intronic
1180848849 22:19000620-19000642 ATGCTTAAGCGAATTGAGAAAGG - Intergenic
1184017065 22:41794285-41794307 CTTTTTAAGCCAATAGGAGAAGG + Intronic
949546841 3:5080060-5080082 TTTTTTAAACAAAATGGGGATGG - Intergenic
949981399 3:9504019-9504041 TTTTTTAAGAGATTGGGGGAGGG - Intronic
950546580 3:13641606-13641628 TTTTCTAAGAGAACTGGGGAAGG - Intergenic
952594934 3:35005789-35005811 ACTTTTAAGGGGATTGTGGAGGG + Intergenic
954100546 3:48369235-48369257 ATTTTTAAGAGAAATAAGGAAGG - Intergenic
956574394 3:70735743-70735765 ATGTTTAAAAGAATTGGGGGTGG - Intergenic
957806894 3:85159369-85159391 GATTTTAAGGGAATTGTGGAAGG + Intronic
959255348 3:104004212-104004234 ATTGTTGAGGGAGTTGGGGACGG - Intergenic
959527792 3:107397308-107397330 ATTTTTAAGCCAGTTGGATAGGG - Intergenic
959878893 3:111419737-111419759 ATTTGTAAGTGTTTTGGGGAAGG + Intronic
960441377 3:117693110-117693132 AGTTTTAAGCTAATTGGAGTAGG - Intergenic
962254658 3:133862086-133862108 ATTTTTAAGAGCACTGGGAAAGG + Intronic
962641024 3:137386651-137386673 ATTTTTAAGCTAACTGTTGAAGG - Intergenic
962995330 3:140621840-140621862 ATTTTATAGTGAATTGGGAATGG + Intergenic
964528795 3:157644823-157644845 AATTTTAAGAGAATTTGGGTTGG + Intronic
964649700 3:158996744-158996766 ATTTTTAAATGAATAGGGGGAGG - Intronic
964916231 3:161845696-161845718 GTTATTAAGCTAATTAGGGAGGG - Intergenic
965276660 3:166691762-166691784 AGTTTAAAGTAAATTGGGGATGG + Intergenic
967109305 3:186279486-186279508 AATGCTAAGAGAATTGGGGAAGG - Intronic
970560429 4:17276783-17276805 ATTGTTAAGTGGATTGGGGGTGG - Intergenic
971133125 4:23835670-23835692 ATTTTTTAGTGAATTAAGGAAGG + Intronic
971543425 4:27852185-27852207 ATTATTATGCAAATTGAGGATGG + Intergenic
971930106 4:33070401-33070423 ATTTTCAAGCAAAGTGTGGAAGG + Intergenic
972278948 4:37585122-37585144 ATTTCAGAGCGAATTGTGGAGGG + Intronic
973807876 4:54543017-54543039 ATTCTTCAGGGATTTGGGGATGG + Intergenic
975453185 4:74554267-74554289 ATTTTTAAGCAAATTAAGAATGG + Intergenic
977285542 4:95101588-95101610 ATTTTTAAGCCAAATGTGGGGGG - Intronic
977878604 4:102178399-102178421 AGTTTTAAGTGAAATGGTGATGG - Intergenic
979093232 4:116514861-116514883 AGTTTTAAGCACATTGTGGAAGG - Intergenic
980425834 4:132627343-132627365 ATTTATAAGCCAACTGGGAAAGG + Intergenic
980530641 4:134047878-134047900 ATTTTAAAGGGAGTTGGAGAAGG + Intergenic
981342794 4:143641440-143641462 ATCCTTAAGTGAATGGGGGATGG + Intronic
981852304 4:149245174-149245196 ATTTTTCATCAAACTGGGGAAGG + Intergenic
982202036 4:152970948-152970970 TTTTTTGAGTGAAGTGGGGATGG - Intronic
982876044 4:160651244-160651266 ATTATTAAGCTAAATGAGGAAGG + Intergenic
983185334 4:164694160-164694182 TTTTTTAATCAAATTAGGGAAGG + Intergenic
985054266 4:186022584-186022606 AATTTTAAGCAAATTGGTGGTGG - Intergenic
987170027 5:15245420-15245442 ATTTTTAATGGAATTTTGGAAGG + Intergenic
989575628 5:42985494-42985516 GTTTTTAAGGGGATTGTGGAGGG + Intergenic
991092701 5:62708391-62708413 GTTTTTAAGGGAATTGTGAAGGG + Intergenic
991454620 5:66789147-66789169 ATTATGAAGCTAATTGGGCAAGG - Intronic
995472889 5:112522569-112522591 GTTATTAAGCTAATTAGGGAGGG - Intergenic
997910904 5:137872259-137872281 ATTATAAAGGGAATTTGGGAGGG - Intronic
999009229 5:148016768-148016790 ATTTTTAATGGAATTTAGGAAGG - Intergenic
1001259034 5:170210855-170210877 TTTGTTGAGGGAATTGGGGAAGG + Intergenic
1004668014 6:17766735-17766757 CTTTTTAATCGAGGTGGGGAGGG + Intronic
1006434310 6:34018381-34018403 ACTTTGAAGCGAACTGGGGCTGG + Intergenic
1007596507 6:43054067-43054089 ACTTGTAAGGGAATTGGGGTGGG + Exonic
1009785002 6:68325260-68325282 ATTTTTAAGAAAATTGGTAAAGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1012942644 6:105431765-105431787 ATTTTTAAGTTAAATGTGGAAGG + Intergenic
1013595136 6:111653775-111653797 ATTTGTAAGATAATTGGGAAGGG - Intergenic
1016584760 6:145672292-145672314 GTTTTAAAGGGATTTGGGGAAGG - Intronic
1018691716 6:166350737-166350759 ATTATTAAGCATATTGAGGAAGG - Intergenic
1020707542 7:11564503-11564525 ATTTGTAAGAGAATTAGGAAGGG - Intronic
1020727670 7:11836026-11836048 ATTATTAAGCTTATTAGGGAAGG + Intergenic
1021339470 7:19446157-19446179 ATTTTTAAGAGACTTAGGCAAGG + Intergenic
1023219601 7:37905721-37905743 ATTTTTAATCAATATGGGGAAGG + Intronic
1023933454 7:44722011-44722033 AGGTTTAAGCAAATTGTGGAAGG - Intergenic
1026604821 7:71806812-71806834 GTTTTTAAGGGGATTGTGGAGGG - Intronic
1026742549 7:72988226-72988248 ATTTTTCAACGAATGGGGGTGGG - Intergenic
1026802401 7:73408622-73408644 ATTTTTCAACGAATGGGGGTGGG - Intergenic
1027101186 7:75376852-75376874 ATTTTTCAACGAATGGGGGTGGG + Intergenic
1027194681 7:76021611-76021633 GTTTTTAAGGGGATTGGGGAGGG - Intronic
1027573044 7:79895833-79895855 ATTTTTTAGCAAAATGGGTATGG + Intergenic
1027591291 7:80122170-80122192 AATTTTAAAAGAATTGGAGAAGG + Intergenic
1028285912 7:88998715-88998737 AATGTTAAGAGAACTGGGGATGG + Intronic
1029055903 7:97742627-97742649 ATTTTCAAGCTAATTTGAGAAGG + Intergenic
1030854973 7:114544164-114544186 CTTTTTAAGGGAATAGGGAAAGG + Intronic
1031173675 7:118322176-118322198 ATCTTTAAGAGGATTGTGGAAGG + Intergenic
1032010050 7:128339974-128339996 GTTTCTAAGCAAAGTGGGGAGGG - Intronic
1032637212 7:133722631-133722653 ATTTTAAAGGTCATTGGGGAAGG + Intronic
1033951992 7:146796368-146796390 GTTTTTAAGGGGATTGTGGAGGG + Intronic
1036445872 8:8821443-8821465 AGTTGTAAGCAAATTTGGGAGGG - Intronic
1038391724 8:27208174-27208196 GGTGTTTAGCGAATTGGGGAAGG - Intergenic
1038634541 8:29275015-29275037 ATTTTTCAACAAAGTGGGGATGG - Intergenic
1040100362 8:43495572-43495594 ATTTTAAAGCTAATGAGGGATGG + Intergenic
1040355584 8:46614934-46614956 ATCTTTGAGGGATTTGGGGATGG - Intergenic
1040920688 8:52613090-52613112 CTTTTTATGGGATTTGGGGATGG + Intergenic
1041249819 8:55923197-55923219 TTTTTGAAACGAATTGGGGGTGG + Intronic
1042304028 8:67313236-67313258 ATTCTTAAGCTAATCAGGGAAGG - Intronic
1045147872 8:99367964-99367986 ATTTTTAAAGGGATTGGGGAAGG + Intronic
1047850981 8:128857758-128857780 ATTGTTAAGAGAATTTAGGAAGG + Intergenic
1047916782 8:129592053-129592075 ATCTTTAACTGAATTGGGGCTGG - Intergenic
1048358464 8:133673723-133673745 CTTTATAAGCCAAATGGGGATGG + Intergenic
1048374541 8:133811431-133811453 TATTTTAAGGGAATGGGGGAAGG + Intergenic
1048460647 8:134618547-134618569 ATATTTAACCAAATTGAGGAGGG - Intronic
1049295866 8:141837328-141837350 ATTATTAAGCTAATCAGGGAGGG - Intergenic
1051504006 9:17808188-17808210 ATTTTTAAGAGAAAAGGGGGAGG - Intergenic
1052246995 9:26347753-26347775 GTTATTAAGCTAATCGGGGAGGG + Intergenic
1052567860 9:30181699-30181721 ATTTTCAGGCAAATTGTGGAAGG - Intergenic
1052732625 9:32307470-32307492 ATTTTTAAGGGGATTGTGGAGGG - Intergenic
1057362819 9:94390526-94390548 ATTTTTAATCTTATTGGGGGAGG + Intronic
1057660519 9:96997567-96997589 ATTTTTAATCTTATTGGGGGAGG - Intronic
1058001974 9:99875313-99875335 TATTTTAAGAGAGTTGGGGAGGG - Intergenic
1058101368 9:100920943-100920965 ATTTCAAAGGGAATTTGGGAGGG + Intergenic
1058568355 9:106311564-106311586 ATTTGTAAACAAATTGGGCAGGG + Intergenic
1185472913 X:395612-395634 AATTTTAAGCAAATTGAGAATGG + Intergenic
1188106200 X:26150191-26150213 ATTTTTAAGTGAATTTAGAAAGG - Intergenic
1188737886 X:33741376-33741398 CTTATTAAGCTAATTAGGGAGGG - Intergenic
1192587389 X:72329744-72329766 ATTTTTAAGCGAATTGGGGAGGG - Exonic
1193336815 X:80299351-80299373 ATATTTAATGGGATTGGGGATGG - Intergenic
1194763646 X:97824005-97824027 TTTTTTAAGGGGATGGGGGAGGG - Intergenic
1195390587 X:104358071-104358093 GTTTTTAAGCGGATTGTGGAGGG + Intergenic
1195760220 X:108237600-108237622 ATTTTTAAGTGATTTTGGAAGGG - Intronic
1197279906 X:124523185-124523207 ATTTTTAAGACAATTGGTCAGGG - Intronic
1197570520 X:128145666-128145688 AGGTTTAAGCGAATTGTGGAAGG + Intergenic
1197671524 X:129283651-129283673 ATTATTAAGCTAATCAGGGAGGG - Intergenic
1198181900 X:134218390-134218412 ATGTTTAAGCAAGTTGTGGAAGG - Intergenic