ID: 1192589592

View in Genome Browser
Species Human (GRCh38)
Location X:72348929-72348951
Sequence AATCACCCTCCCCCAAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192589588_1192589592 -3 Left 1192589588 X:72348909-72348931 CCTTAACAGCAATTTAGTCCAAT 0: 1
1: 0
2: 1
3: 13
4: 254
Right 1192589592 X:72348929-72348951 AATCACCCTCCCCCAAGGAAGGG 0: 1
1: 0
2: 1
3: 22
4: 192
1192589586_1192589592 22 Left 1192589586 X:72348884-72348906 CCTAGAATCTTAGGGTTGGAAGG 0: 1
1: 2
2: 7
3: 32
4: 242
Right 1192589592 X:72348929-72348951 AATCACCCTCCCCCAAGGAAGGG 0: 1
1: 0
2: 1
3: 22
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192589592 Original CRISPR AATCACCCTCCCCCAAGGAA GGG Intronic
900106600 1:984109-984131 AGCCACCCTCCCACCAGGAAGGG - Intergenic
900356348 1:2266626-2266648 CATCACCCTCCTCCCTGGAAAGG - Intronic
901367124 1:8762138-8762160 AATCTCCTTCCCCTAAGGAGAGG + Intronic
902646923 1:17806008-17806030 AATCAGCCACTCCCAAGGACCGG - Intronic
904971382 1:34421820-34421842 AACCCCCCTCCCCAAAAGAATGG - Intergenic
907685314 1:56605686-56605708 AATCTCTGACCCCCAAGGAAAGG + Intronic
907771858 1:57473346-57473368 AATTGCCCTCCCTCAAGGGAAGG + Intronic
908309532 1:62864487-62864509 ATTAACCCTCCCCCAAAGACTGG + Exonic
910446225 1:87301313-87301335 AATCAGACTCCCCCAAGAAATGG + Intergenic
910712648 1:90197556-90197578 CATCCCCCTTCCCCATGGAAGGG - Intergenic
911693959 1:100866602-100866624 AATTACCCTCTCTGAAGGAATGG + Intergenic
912211283 1:107559939-107559961 ACTCACTCACCACCAAGGAAGGG + Intergenic
912222214 1:107690835-107690857 ATTCACCCTCTGCCAAGGAGAGG + Intronic
913256103 1:116955151-116955173 AGTGACCCTCCCCTAAAGAAAGG - Intronic
914417455 1:147496972-147496994 AAGCACACTCCTCCAGGGAAAGG + Intergenic
915985398 1:160459347-160459369 AGTCTCCCTTCCCCATGGAAGGG + Intergenic
917101318 1:171448514-171448536 AATTGCCCTCCCCCAAAAAATGG + Intergenic
917159810 1:172044868-172044890 AACCATCCTCCCCACAGGAAAGG - Intronic
918939617 1:190975202-190975224 AAACCCTGTCCCCCAAGGAAGGG - Intergenic
920231005 1:204469500-204469522 ACTCACTCTCCCCACAGGAAGGG - Exonic
921295918 1:213703762-213703784 AATCAAACTCCCCAAAGTAAAGG - Intergenic
922333397 1:224597781-224597803 AATTAATCTACCCCAAGGAAGGG + Intronic
1063410235 10:5831608-5831630 AGTCACCGTCCCCCACGGACGGG - Intronic
1065224111 10:23525243-23525265 AAACACCCTACCCCAAAGTATGG - Intergenic
1070839439 10:79473404-79473426 AATCATCCTTCCCCAAAGAAGGG + Intergenic
1073391549 10:103181394-103181416 CATCACCCTCCCCCAAAGAAAGG + Intronic
1075653867 10:124148216-124148238 AATCAGCCTGCCCCAAGTGAAGG + Intergenic
1076737373 10:132464912-132464934 AGCCACCATCCCCCAGGGAAGGG - Intergenic
1076853154 10:133102954-133102976 ACTGACCCTCCCCCATGGACCGG - Intronic
1077694004 11:4377031-4377053 AATCACCATCACCCGATGAATGG + Intergenic
1079051045 11:17159923-17159945 AATGACCCTCCCAAAAGTAAGGG - Intronic
1079680336 11:23288270-23288292 AATCAACCTCCCTGAAGGCATGG - Intergenic
1080293541 11:30698959-30698981 AAACACCATTCCCCAATGAAAGG + Intergenic
1081763096 11:45590883-45590905 AATTCCCCTTCCACAAGGAAGGG + Intergenic
1081779719 11:45701753-45701775 GCTCACTCTCCCCCAAAGAAGGG + Intergenic
1082842533 11:57700824-57700846 AATCCCTCTCCCCCAAGGAGGGG - Exonic
1083781647 11:64921497-64921519 TATCTCCCTCCCCCCAGGGATGG + Intronic
1085880467 11:80462281-80462303 AACCTCCCTCCACCAAGGAAAGG + Intergenic
1088951243 11:114572150-114572172 AATCCCCCTTCCCCTAGGAATGG - Intronic
1089013914 11:115151506-115151528 GATCACCCTCCCACCAGGATGGG - Intergenic
1089661682 11:119990197-119990219 AAACACCCTTCCCCAAAGAAGGG - Intergenic
1090090445 11:123692326-123692348 AATGACCCTCCCCTCATGAATGG - Intergenic
1090626557 11:128613719-128613741 TGTCTGCCTCCCCCAAGGAATGG - Intergenic
1092151123 12:6249463-6249485 AATCTCTCTCTCCCAAGGAGAGG + Intergenic
1094216932 12:27952426-27952448 AATCAGCATACCCCAGGGAAAGG + Intergenic
1094769620 12:33639125-33639147 AATTCCCCTTCCCCAAGGCAGGG + Intergenic
1095528324 12:43154567-43154589 ACTCACCCTTCACCAAGGCACGG - Intergenic
1098575551 12:72037872-72037894 AATCAGCCCCACCCAAGGTAAGG - Intronic
1100778271 12:97996088-97996110 ATTCACTCACCCCCAAGGAAGGG - Intergenic
1102001038 12:109558327-109558349 AACCCCCCTCCCAGAAGGAAAGG + Intronic
1102945137 12:116980031-116980053 AATCAGCTTCCCCCAAGAACTGG - Intronic
1103420841 12:120780899-120780921 AAACTCCCTCCCCCAAAAAAAGG + Intronic
1108505073 13:51105545-51105567 AATCTCACTCCCCTAAGCAATGG + Intergenic
1109197054 13:59390058-59390080 TCTCACCCTTCCCCTAGGAATGG + Intergenic
1111146399 13:84186682-84186704 AACTACCCACCCCCAATGAAAGG - Intergenic
1111856977 13:93650450-93650472 AATCATGCTCCCCAAAGGAATGG + Intronic
1114557089 14:23568273-23568295 CAACCCCCTCCCTCAAGGAATGG - Exonic
1121215719 14:92246209-92246231 ACTCACCCCCACCCAGGGAAGGG + Intergenic
1122146214 14:99690418-99690440 AATCACGTTCTCCCAGGGAAAGG - Intronic
1122387732 14:101360511-101360533 AAACACCCTCCCCCACAAAAGGG - Intergenic
1124590658 15:31050353-31050375 CATCACCCTTCCCCAGGGGAAGG - Intronic
1124631813 15:31342266-31342288 AGTGACCCCACCCCAAGGAAAGG + Intronic
1125439966 15:39691178-39691200 AGTCACCCTTCCCCAAAGACTGG - Intronic
1127290959 15:57570639-57570661 ACTCACTCACCCCCAAGAAAGGG - Intergenic
1129126699 15:73447896-73447918 AATCTCCCTCCCCCAGCCAAGGG + Intronic
1130765563 15:86867153-86867175 ATTCCCCCACCCCCAAGAAAAGG - Intronic
1132379523 15:101357143-101357165 AAGCACCCTGCCCCAAGCACAGG + Intronic
1132881390 16:2163153-2163175 AATCACCCTCCCCAGAAGAGAGG - Intronic
1133196563 16:4175033-4175055 GGTCACCATCCCCCAAGGATGGG + Intergenic
1133842305 16:9420785-9420807 AAGCAAACTCTCCCAAGGAATGG + Intergenic
1133874457 16:9720692-9720714 CCTCTCCCTCCCCGAAGGAAAGG + Intergenic
1133965249 16:10526445-10526467 AATCTCCCTCCCGCCAGGGAAGG + Intergenic
1134895905 16:17886635-17886657 AATCCCTCTTCCCCAAGGATGGG + Intergenic
1135796444 16:25447691-25447713 AATCACCCCCCACCAATGAGTGG - Intergenic
1138068362 16:53965500-53965522 AATCACCCTTCCCCACCCAAGGG + Intronic
1141831058 16:86510240-86510262 TCTCGCCCTCCCACAAGGAAAGG - Intergenic
1142027305 16:87821411-87821433 AATCAACCTCCCTGAAGGCATGG + Intergenic
1143903594 17:10192833-10192855 AATCACCCTCCTCCTTGGTATGG - Intronic
1144196261 17:12898051-12898073 ATTCACCCTCCCCAAGAGAAGGG + Intronic
1144369875 17:14579893-14579915 AATCACTCTCTACCAAGGAAGGG - Intergenic
1145113953 17:20190803-20190825 CATCCCCCACCCCCAAGGGAGGG - Intronic
1145393822 17:22478105-22478127 AATAATCCTCCCGGAAGGAAGGG + Intergenic
1146905112 17:36613193-36613215 AATCCCCCTCCCCCTAGGTTGGG + Intergenic
1146926436 17:36749109-36749131 AACCTTCCTCCTCCAAGGAAGGG - Intergenic
1149036589 17:52141143-52141165 AGTCACCCTCCCCTAAGGCATGG - Intronic
1149619608 17:58033554-58033576 ACTCACTCACCCTCAAGGAAGGG + Intergenic
1150698099 17:67423360-67423382 CATCCCCCTCTCCCAAGGTAAGG - Intronic
1151226591 17:72652539-72652561 ACTCACCCTCACCCCAGGACAGG - Intronic
1151408423 17:73904250-73904272 AATAACCCTCCGCCAAGGCAGGG - Intergenic
1152014728 17:77742873-77742895 GATTAACCTCCCCCAAAGAAAGG - Intergenic
1153612530 18:6900704-6900726 AATCAGCGTCCCAAAAGGAAAGG + Intronic
1154141172 18:11826155-11826177 ACTCACCATCCCCCATGGGATGG + Intronic
1155826276 18:30447120-30447142 AATCACCCTTCCCCAAAATAAGG + Intergenic
1157618147 18:48999834-48999856 AATGACCCTCCGCAAATGAACGG - Intergenic
1158027802 18:52922735-52922757 GAACACCCTCCTCCAAGGACTGG + Intronic
1162514954 19:11142345-11142367 GATCACCCTGCCCCTAGGGAGGG + Intronic
1163106056 19:15123644-15123666 AATCCCCCTGCCCCAGGTAAGGG + Intronic
1165447977 19:35867163-35867185 TATCACTCTCCACCAAGGAAGGG + Intronic
1165871783 19:38978021-38978043 AATCACACTCCCTGCAGGAAAGG - Intergenic
1168358638 19:55719148-55719170 AATCAGTCTAACCCAAGGAAGGG - Intronic
926670857 2:15575598-15575620 AATGACCGTCCACCATGGAAGGG + Intergenic
926990702 2:18676860-18676882 CCTCACCCTCCCCCAATGAGAGG - Intergenic
927408075 2:22795211-22795233 AATCACCATCACACAAGGAAGGG + Intergenic
929178004 2:39001570-39001592 CCTGACCCTCCCCCAAAGAAGGG + Intronic
929953145 2:46432450-46432472 ACTCACCCTCCCCCCAGGTTGGG - Intronic
930890175 2:56375565-56375587 AATGCCCCACCCCCAAGGAATGG - Intronic
932925572 2:75969490-75969512 ACTCTCCCTTCCCCTAGGAATGG - Intergenic
934992063 2:98928944-98928966 AATCACCCAGCCCCATGGAGAGG + Intronic
935282074 2:101526991-101527013 AATCTGCCTCACCCAAGGAAGGG - Intergenic
935321370 2:101892568-101892590 ACTCCCCCACCCCCAAGAAAAGG - Intronic
938670647 2:133583291-133583313 ACTCACCCACCACCAAGGGATGG - Intergenic
939078113 2:137627204-137627226 ACTCACTCTCCCCCAAGGGAGGG + Intronic
939888328 2:147705905-147705927 ACTCACTCACCCCCAAGGGAGGG + Intergenic
940269812 2:151877945-151877967 AAGCTCCCTGCCTCAAGGAAAGG + Intronic
942953352 2:181747250-181747272 AATTACCCACCCACAAGCAATGG + Intergenic
945736437 2:213606358-213606380 ATTCACGCTCCCACAAGCAATGG + Intronic
946090039 2:217213806-217213828 AATCTCCTTCCCCCAAGGAGGGG - Intergenic
946230341 2:218287341-218287363 ACACACCCTCTCCCAAGGAGGGG + Intronic
948760204 2:240185544-240185566 ACTCACCCTTCACCTAGGAAAGG - Intergenic
948760264 2:240185900-240185922 ACTCACCCTTCACCTAGGAAAGG - Intergenic
1169976991 20:11340741-11340763 AATCAACTTCACCCAAGGAGAGG + Intergenic
1172458963 20:35100854-35100876 AATCCCTCTTCCCCAAGGCAGGG + Intergenic
1173253441 20:41376411-41376433 AGTCACCCTCCCCAGAAGAATGG + Intergenic
1173584086 20:44168907-44168929 ACTCACTCACCCCCAAGGGAGGG - Intronic
1175773320 20:61637194-61637216 AAGCACCCTCTCCCAGGAAAGGG + Intronic
1176293829 21:5060062-5060084 AATCAATCTCCCCCAAGAGACGG - Intergenic
1177141077 21:17358832-17358854 AATCCCCCTTACTCAAGGAAGGG + Intergenic
1177703896 21:24674872-24674894 ACTGCCCCTCCCGCAAGGAATGG + Intergenic
1179863430 21:44203586-44203608 AATCAATCTCCCCCAAGAGACGG + Intergenic
1183708668 22:39489909-39489931 AGCCAGCCTGCCCCAAGGAAGGG - Exonic
1184830719 22:46984653-46984675 AATAATTCTTCCCCAAGGAAAGG - Intronic
949860908 3:8503949-8503971 AATCACACTCCCCTATGCAAAGG - Intronic
952384836 3:32832791-32832813 AATCGTCCACCCCCTAGGAAGGG - Intronic
952494548 3:33904354-33904376 ATTCATTCACCCCCAAGGAAGGG - Intergenic
953015997 3:39076699-39076721 AATAACCCTCGCCTAAGGACGGG - Intronic
954068452 3:48125621-48125643 AATCAGCCTCCACCTTGGAAAGG + Intergenic
955094507 3:55783784-55783806 AAACACCCATCCCCAAGGCAAGG + Intronic
961917438 3:130392049-130392071 ATTCACCTTACCCCAAGTAATGG + Intronic
962894082 3:139698456-139698478 GTTCCCCCTCCCCCAAGAAATGG + Intergenic
963152592 3:142061508-142061530 AATCACCCTCTCCAATGGAGAGG + Intronic
964299439 3:155271538-155271560 TCTCTCCCTTCCCCAAGGAATGG - Intergenic
964412210 3:156409430-156409452 ATTCACCCTGGCCCAAGGAGGGG + Intronic
965638244 3:170806470-170806492 AATCTCTCTCTCCCAAGCAAAGG + Intronic
967134539 3:186502328-186502350 AGACACCCTCCCCCAGGCAAAGG - Intergenic
969725077 4:8913948-8913970 AGTCACGCTCCCCCAAGCCAAGG + Intergenic
971431693 4:26574711-26574733 ACTCACTCACCCCCAAGGGAGGG + Intergenic
972879320 4:43404909-43404931 CACCACCCTCCCCAATGGAATGG - Intergenic
975623320 4:76315901-76315923 CCTCCCCCTCCCCCAAGGGATGG - Intronic
977169537 4:93743685-93743707 ACTCACTCATCCCCAAGGAAGGG + Intronic
978047058 4:104143116-104143138 AATCACCCTCACTAAAAGAAAGG - Intergenic
978290337 4:107130367-107130389 TATAACCCTACCCCCAGGAATGG - Intronic
978474895 4:109115585-109115607 AATCATCTTTGCCCAAGGAATGG - Intronic
978835872 4:113149074-113149096 ACTCATCCTTCACCAAGGAAAGG - Intronic
981315523 4:143336655-143336677 ACCCACCCTCCCCCGAGGAGAGG + Intergenic
987051414 5:14149507-14149529 AATCACCTGCCCCCCGGGAAAGG + Intronic
989091954 5:37743205-37743227 AACCCCCCTCCCCCAAGCTAAGG + Intronic
991366316 5:65871676-65871698 AATCAACTTCTCCCCAGGAATGG - Intronic
991955878 5:71995633-71995655 AATGAATGTCCCCCAAGGAACGG - Intergenic
994522829 5:100863092-100863114 AATCCTCCTCCCCAAAGGTAGGG + Intronic
995014070 5:107290212-107290234 AATCACCCCCCCGCAAAAAAAGG + Intergenic
995205084 5:109470411-109470433 ACTCACTCACCCCCAAGGAAGGG - Intergenic
995350015 5:111164317-111164339 ATTCACCCTTCCCTAAGAAAAGG + Intergenic
995535384 5:113130638-113130660 ACTCACTCACCCACAAGGAAGGG - Intronic
995550238 5:113274275-113274297 AACCAACTTCCCCCTAGGAAAGG + Intronic
997251173 5:132389765-132389787 AGTCACCCGCTTCCAAGGAATGG + Intronic
997963128 5:138337789-138337811 AATCCCCCTTCCCCCAGCAAAGG - Intronic
1000629715 5:163578720-163578742 GATTTCCCTCTCCCAAGGAATGG - Intergenic
1001006854 5:168059642-168059664 TATATCCCTTCCCCAAGGAAGGG + Intronic
1001243212 5:170085965-170085987 AATACCCCTCCCTTAAGGAAAGG - Intergenic
1003667101 6:8121578-8121600 ACTCACTCACCTCCAAGGAAGGG - Intergenic
1005212121 6:23478592-23478614 AAACACCATTCCCCAATGAAAGG + Intergenic
1005316354 6:24606365-24606387 CATCACCGTCACCCAAAGAAGGG - Intronic
1005442876 6:25890151-25890173 TATCACCATCCCAGAAGGAAGGG + Intergenic
1006784344 6:36655229-36655251 AATTACCATGCCACAAGGAAGGG - Intergenic
1013507270 6:110813947-110813969 AATTACCCTCCCCCAAAGCTAGG - Intronic
1015686119 6:135863528-135863550 AATCACACTCCCCCCAGTCAAGG - Intronic
1019116608 6:169769277-169769299 TTTCACCTTCCTCCAAGGAAGGG - Intronic
1019183184 6:170205388-170205410 AACCACCCCCACCCAAGGCAAGG - Intergenic
1019918572 7:4149098-4149120 CATCTCCCTGACCCAAGGAAGGG + Intronic
1021327889 7:19296809-19296831 AATCCCCTTCACCCAAGCAATGG + Intergenic
1021866474 7:24963245-24963267 ATTCATCCTCCCCCATGGAAAGG + Intronic
1023615209 7:42012866-42012888 ACTCTCCCTGCCCCCAGGAAAGG + Intronic
1024265283 7:47601601-47601623 AATCACCTTCCCCCATGAATTGG - Intergenic
1024815406 7:53263142-53263164 AATCTCCCTCCCCCTACCAATGG + Intergenic
1030084411 7:105804377-105804399 ACCCACCCTGCCCCAAGGTAAGG + Intronic
1030498013 7:110324098-110324120 AACCTCCCCCCCCCAAGAAAAGG - Intergenic
1031431352 7:121674226-121674248 AAGCACCCCCCCCCAAAAAAAGG - Intergenic
1033130753 7:138743615-138743637 ATTCTTCCTCTCCCAAGGAAGGG - Intronic
1033440152 7:141371239-141371261 ACTCACTTACCCCCAAGGAAGGG - Intronic
1033649837 7:143332461-143332483 ATTCACCTTCCCACCAGGAATGG + Exonic
1035785195 8:2254350-2254372 AATCACGCTCCCTCCAGGACAGG - Intergenic
1035807613 8:2467366-2467388 AATCACGCTCCCTCCAGGACAGG + Intergenic
1039727377 8:40233282-40233304 AATCAGCCTCCCCAAAGGCTTGG - Intergenic
1039790358 8:40871064-40871086 ATTCTCCATCCCCAAAGGAAAGG + Intronic
1040947345 8:52897417-52897439 AGTTACTCACCCCCAAGGAAGGG + Intergenic
1042980611 8:74522707-74522729 AATCACCCTCACTGAAAGAAAGG + Intergenic
1046117993 8:109807419-109807441 ATTCACCATACCCCAAGGACAGG - Intergenic
1048235169 8:132682941-132682963 ATTCACTCACCCCCAAGGTAAGG + Intergenic
1051277364 9:15409530-15409552 AATTACCTTCCCCCAAGCAATGG + Intergenic
1052200402 9:25771756-25771778 AACCATCCTCCCACCAGGAATGG + Intergenic
1052790431 9:32870417-32870439 AATCATCATCACCCAAGGTAGGG - Intergenic
1053000580 9:34575258-34575280 AAGCCCCCTCCACCCAGGAAAGG + Intronic
1056529031 9:87470674-87470696 CACCACCCTCCACCAAGAAAAGG - Intergenic
1056933206 9:90895759-90895781 ACTCACCCTCCACAAAGCAAAGG + Exonic
1060200083 9:121647168-121647190 CACCAGCCTCCCCCAGGGAAGGG - Intronic
1061593538 9:131614136-131614158 CAACACCCCCCCCCAAGGAGGGG + Intronic
1188542856 X:31268610-31268632 AATCCCTCTTCCCCAAGGATCGG - Intronic
1188587580 X:31796789-31796811 ACTCAACCTGCCCCCAGGAAGGG - Intronic
1189388554 X:40557136-40557158 AAGAACCCTCCCCTAAGGAAGGG - Intergenic
1192196598 X:69032916-69032938 GCTCAACTTCCCCCAAGGAAGGG + Intergenic
1192412334 X:70945033-70945055 ACTCACTCACCCCCAAGGGAGGG - Intergenic
1192589592 X:72348929-72348951 AATCACCCTCCCCCAAGGAAGGG + Intronic
1192707345 X:73540805-73540827 GATCACCCTCCCCCAGGCAAGGG + Intergenic
1193049686 X:77086821-77086843 AGTCACCGTCCCCCAAGACAAGG + Intergenic
1194464577 X:94217691-94217713 ATTCACTCTCCCCTAAGTAAAGG + Intergenic
1195886077 X:109638900-109638922 AATGACCCTGCACCAGGGAAAGG + Intronic