ID: 1192591536

View in Genome Browser
Species Human (GRCh38)
Location X:72363986-72364008
Sequence CCTTGGTTCAACAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192591536 Original CRISPR CCTTGGTTCAACAGGGAAGC AGG Intronic
903008760 1:20315806-20315828 ACTTGGCACAACAGAGAAGCTGG + Intronic
903743730 1:25573193-25573215 CCTGGGTGCATCAGGGGAGCTGG - Intergenic
903942556 1:26941797-26941819 CCTTGACTCCCCAGGGAAGCAGG + Exonic
905646455 1:39627904-39627926 CCTTGGCTCAAAAGGCAATCTGG + Intronic
906282916 1:44566298-44566320 TGTTGGTTCAACAAGGAAGGGGG + Intronic
908159603 1:61393611-61393633 CCATGGGTGGACAGGGAAGCCGG - Intronic
909718385 1:78738184-78738206 CATTGGTTAAACATGGAAACAGG - Intergenic
911891095 1:103372998-103373020 CCTTGTTTCCACAGGAAAACTGG + Intergenic
912203311 1:107482722-107482744 CCTTGCTGAAACAGGGAAGGGGG + Intronic
912416682 1:109513241-109513263 GCGTTGTTCAACAGGGTAGCTGG - Intergenic
912432074 1:109633256-109633278 CTTTGTTTTAACAAGGAAGCAGG + Intergenic
916653825 1:166855071-166855093 CCTTGGTTGATCAGAGAAGTGGG + Intronic
917836314 1:178944165-178944187 CCTGGGTACAACATGGAAGTGGG + Intergenic
1063116321 10:3074415-3074437 CCTTGGGTGAACTGGGAAGCAGG + Intronic
1065514172 10:26507970-26507992 CCTTGATTCAACAAAGAAGATGG + Intronic
1065635588 10:27729892-27729914 CCCTGGTTCAACAGGAATGGAGG + Intronic
1067682487 10:48449780-48449802 GCTTGGTTCAGCAGGGAAACTGG + Intronic
1068072964 10:52218931-52218953 CTTTGGTTCAACACAGAAACTGG - Intronic
1070157994 10:73848120-73848142 TCTTGGTTCCTCAGGGAAGTAGG - Intronic
1070543606 10:77435437-77435459 CCTTTGTTCAAAAGGGAGACAGG + Intronic
1070981848 10:80654868-80654890 TCAGGGTTCATCAGGGAAGCAGG - Intergenic
1073603617 10:104871083-104871105 CCGTGGTTCCTCTGGGAAGCAGG - Intronic
1075065857 10:119288459-119288481 CTTTGGGGAAACAGGGAAGCAGG - Intronic
1075571967 10:123552712-123552734 ACCTGGTTCAGCAGAGAAGCTGG - Intergenic
1076196734 10:128523944-128523966 CCTTGGTACAACTGAGAAGAGGG + Intergenic
1077921915 11:6647645-6647667 CCTTGTTTGAAAATGGAAGCCGG - Intronic
1078730819 11:13972320-13972342 TCTAGGTTAAAGAGGGAAGCAGG - Intronic
1079375373 11:19887329-19887351 CCTGGGCTCACCAGGGAGGCCGG - Intronic
1079443070 11:20534698-20534720 CCTTGATTCCACAGGGCTGCAGG - Intergenic
1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG + Intergenic
1087107327 11:94423549-94423571 CCTCTGTCCCACAGGGAAGCTGG - Intronic
1088920228 11:114255148-114255170 GCTTGGTCCAGCAGGGCAGCAGG - Intergenic
1089645459 11:119875937-119875959 CCTGGGCTGAGCAGGGAAGCAGG + Intergenic
1090006087 11:123003417-123003439 CTTTGGTTCAACAGGTAAAGTGG - Intergenic
1091621673 12:2093722-2093744 CTTTGGCTCAACTGGGAAGTTGG + Intronic
1093253991 12:16842824-16842846 CCCTGGGTAAGCAGGGAAGCAGG + Intergenic
1094467741 12:30771540-30771562 CCTTGGATCATCATGGAAGCAGG - Intergenic
1106676999 13:31971057-31971079 CATTGGTGGAACAGGGAAGGAGG - Intergenic
1106842659 13:33701449-33701471 CTTTTTTTCAACAGGGAAACTGG - Intergenic
1107797645 13:44069626-44069648 CCTTGGTTCAAAGGGGAATTGGG - Intergenic
1113815452 13:113166840-113166862 CCTTGGGTAAGCTGGGAAGCTGG - Intronic
1114473409 14:22979081-22979103 CCAGGGTTGAACAGGAAAGCAGG + Intronic
1115098611 14:29670745-29670767 ACTGGGATCAACAGAGAAGCAGG - Intronic
1115289320 14:31752270-31752292 CTTATGTTTAACAGGGAAGCAGG - Intronic
1117871408 14:60204940-60204962 TCATGGTTCAACAGGGAGCCAGG + Intergenic
1120950311 14:90034952-90034974 GCTTGGTTCACCATGAAAGCTGG - Intronic
1123152556 14:106196981-106197003 CCTGGGTACAACAGTGCAGCTGG - Intergenic
1124354126 15:28982881-28982903 CCTGGGGTCATCATGGAAGCTGG - Intronic
1127281494 15:57497212-57497234 CGTTGGTCCAACAGGAAAGAAGG + Intronic
1128739488 15:70073863-70073885 CCTTAGTGGAAAAGGGAAGCTGG - Intronic
1131443246 15:92474584-92474606 GCTTGCTTCAACAGTGAAGAAGG - Intronic
1131531868 15:93200639-93200661 GCTTTGTTGGACAGGGAAGCTGG + Intergenic
1132071011 15:98776591-98776613 CCTGGGCTCAACAGGGAGGTAGG - Intronic
1132649616 16:1014566-1014588 CCTTTGGTGAACAAGGAAGCCGG - Intergenic
1132694167 16:1194702-1194724 CGTTGGCTCATCAGGAAAGCGGG - Intronic
1139009650 16:62616702-62616724 CCATGGTTGAAGAGGGAAGTGGG + Intergenic
1139579773 16:67865604-67865626 CCTTGGATCCAAAAGGAAGCTGG - Intronic
1140458593 16:75119451-75119473 CCTTCCATCAACATGGAAGCAGG - Intergenic
1142522444 17:514632-514654 CATTCTTTCAACAGGGAACCAGG + Exonic
1143930244 17:10415137-10415159 CTTTGGTACTACAGGGAAGCTGG - Exonic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144441657 17:15287967-15287989 CATTGGTTCTACAGGCAAACAGG + Intergenic
1145016680 17:19403273-19403295 CATTGGTTCAGCAGGACAGCAGG + Intergenic
1147278708 17:39339493-39339515 CACAGCTTCAACAGGGAAGCAGG - Intronic
1149003695 17:51782759-51782781 TCCTGGTTCAGCAGGGAGGCAGG + Intronic
1150280689 17:63928298-63928320 CCTTGGTTCTCCAGGCAAACTGG - Intergenic
1150296188 17:64008880-64008902 CCTTGCTTGAAGAGGGAATCAGG - Intronic
1150926547 17:69538478-69538500 CCTCAGTTCCACAGGAAAGCAGG - Intronic
1151287243 17:73121773-73121795 CCTAGGTACAACAGAGAGGCTGG - Intergenic
1156315577 18:35966103-35966125 TTTTGGTTCAACAGGAAGGCAGG - Intergenic
1157981007 18:52380381-52380403 ACTTGGTTCAACTGGTAAGATGG - Intronic
1160238039 18:77101218-77101240 CCTGGGTTCTCCAGGGCAGCTGG + Intronic
1162040158 19:7966031-7966053 CGTTGTTTTAACAGTGAAGCTGG - Intronic
1163345535 19:16739570-16739592 GCCTGGTTCAAGATGGAAGCAGG - Intronic
1164430531 19:28184613-28184635 CATTGGTTCAACCAGGAAGGTGG - Intergenic
1164833084 19:31338117-31338139 CCTTTTTCCACCAGGGAAGCAGG + Intronic
1165604651 19:37091328-37091350 CCTTTGTTCATCAGGGAAGATGG - Intronic
1165719663 19:38070079-38070101 CCGTGGATGAGCAGGGAAGCTGG - Intronic
1167786926 19:51644732-51644754 CCTGGGATCAACAGGGAAGGAGG + Intronic
929526377 2:42706995-42707017 CCTGGGTTACAGAGGGAAGCGGG - Intronic
931073845 2:58686672-58686694 GCTTGGTTAAACAGGGAACAGGG - Intergenic
936067133 2:109340850-109340872 CTTTGATGCAACAGGGAAACAGG + Intronic
936477223 2:112849820-112849842 CCTTCCATCATCAGGGAAGCAGG - Intergenic
937060168 2:118974886-118974908 CCTTGGTCCAACAAGGACTCTGG + Intronic
941480647 2:166005697-166005719 CCTTGGTTCAGCAAAGAAGGAGG + Intronic
944264293 2:197706685-197706707 CCCTGGCTCACTAGGGAAGCAGG - Exonic
944984537 2:205160360-205160382 CCTTGGATCAGCAGGCTAGCTGG + Intronic
945868863 2:215205367-215205389 CCTTCCATCATCAGGGAAGCAGG - Intergenic
946037493 2:216755576-216755598 CCTTGCATCTACAGGGCAGCAGG + Intergenic
946829811 2:223717149-223717171 CCTTGGTCTAAAAGGGGAGCGGG - Intergenic
948764490 2:240212470-240212492 CCTTGGTCCTGCAGGGAGGCTGG + Intergenic
948886009 2:240885178-240885200 CCTTAGTACAACAGGACAGCAGG - Intergenic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG + Exonic
1180593669 22:16960462-16960484 CCTGGGATCAACAGGGAAGGTGG + Intergenic
1183539698 22:38422958-38422980 CCCTGGCTCTGCAGGGAAGCTGG + Intergenic
1184230660 22:43156759-43156781 CCTTGATACGACATGGAAGCTGG - Intronic
953471743 3:43173251-43173273 CCCTGGTCCAACAGGCAAGTTGG - Intergenic
954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG + Intronic
955406287 3:58627598-58627620 CCTTCATTCAACTGGGCAGCAGG + Exonic
956366651 3:68510468-68510490 CCCTGGTTTAAAAGGGATGCAGG - Intronic
958941928 3:100326345-100326367 CATTGCTTGAACAGGGAAGGTGG - Intergenic
960172736 3:114481797-114481819 GCCTGGGTCACCAGGGAAGCTGG + Intronic
960685034 3:120287090-120287112 CCTGGGAGCAACAGGGAACCAGG + Intergenic
961417761 3:126773384-126773406 CCTTGGTTCCACAGGGAGCACGG - Intronic
961785703 3:129345300-129345322 CTTTGGTTCCACAAGGAAGATGG - Intergenic
963080367 3:141386860-141386882 TCTTGGTTCAACTGGGTAGGAGG - Intronic
963760338 3:149281767-149281789 CCTTGGATCAACAGAAAGGCAGG + Intergenic
966895925 3:184445030-184445052 CCTTGGTGCAATTGGGAGGCAGG - Intronic
968076361 3:195817774-195817796 CCATGGTTCAGCAGGGAGGCGGG + Intergenic
972296505 4:37744254-37744276 CCTTGCTGCAACAGGAGAGCAGG + Intergenic
978305528 4:107323749-107323771 CCTGGGAGCAACATGGAAGCAGG - Intergenic
979217414 4:118182165-118182187 AGTTGGTTCATCATGGAAGCAGG + Intronic
984301830 4:177929727-177929749 CCCAGGGTCAACAGGAAAGCAGG + Intronic
986387554 5:7249233-7249255 TCTTGGTGTAACAGGAAAGCAGG + Intergenic
988256202 5:28823179-28823201 CCTAGGTTGCACAGGGCAGCAGG - Intergenic
991142399 5:63259950-63259972 CTTTTGTTCCACAGGGAAGAAGG + Intergenic
994292616 5:98047028-98047050 CCATGGTTAAACAAGGAAACAGG - Intergenic
994635579 5:102341419-102341441 GCTTTGTTCACCAGGGAAACAGG - Intergenic
996405337 5:123098342-123098364 CCGTGGCTCCTCAGGGAAGCTGG + Intronic
996589291 5:125127905-125127927 CCTTGGTTCAACAGATACGTAGG - Intergenic
1000178062 5:158777770-158777792 CCTGGTTTGAACAGGGAACCTGG + Intronic
1000750672 5:165092341-165092363 TGTTGCTACAACAGGGAAGCAGG + Intergenic
1001056526 5:168454551-168454573 CCCTAGTGCAGCAGGGAAGCAGG - Intronic
1007620732 6:43212958-43212980 CCGTGGCTCATCAGGGAGGCAGG + Intronic
1013210010 6:107978348-107978370 CCTTGGCTCAAGATGTAAGCAGG - Intergenic
1013343187 6:109235664-109235686 CCTTGGTACTATAGGGAGGCTGG + Intergenic
1014231297 6:118905211-118905233 CCTGGGTTGAAGAGGGAAACTGG + Intronic
1015966367 6:138698620-138698642 CCTTGGTTCAAAGGGGTAGAAGG + Intergenic
1017965323 6:159259370-159259392 CATTGTGTCAACAGGGAAGGTGG + Intronic
1020255089 7:6498354-6498376 CCTGTGTCCAACAGGGAACCAGG + Intronic
1020717248 7:11690225-11690247 CCTTGGTTCAAGAGGGTGTCAGG + Intronic
1022388116 7:29920698-29920720 GGGTGGTTCAGCAGGGAAGCCGG - Intronic
1028849875 7:95526192-95526214 CCTTGGTTCAACAATGAGGAAGG + Intronic
1043800681 8:84605894-84605916 CCTAGGTTTAACCTGGAAGCAGG - Intronic
1050146112 9:2569420-2569442 CCTTGGAACAACATGGAAGCAGG - Intergenic
1056852561 9:90096705-90096727 CCCTGGTTGAGCAGGGAAGAGGG + Intergenic
1058421710 9:104838872-104838894 CCTTGGGTCAACTTGCAAGCTGG + Intronic
1060027440 9:120185041-120185063 TCTTGGTTCAACAGGCAAAGAGG - Intergenic
1060750509 9:126165470-126165492 CCTTGGTGACAGAGGGAAGCGGG + Intergenic
1061952959 9:133946348-133946370 CCTTGCTGCAAAAGGGAACCTGG + Intronic
1062378751 9:136276719-136276741 CCATGGTTCCACAGGTCAGCAGG - Intergenic
1188767525 X:34114177-34114199 CCTTGGTCTAAAAGGGAAGGGGG + Intergenic
1190623833 X:52316664-52316686 CCTTTGTTGAACAGGGAACCTGG + Intergenic
1191841135 X:65514232-65514254 CCTTGGGTCACCAGGGAGCCAGG - Intronic
1192591536 X:72363986-72364008 CCTTGGTTCAACAGGGAAGCAGG + Intronic
1195150300 X:102061048-102061070 CCTTCCATCAACATGGAAGCAGG - Intergenic
1201319426 Y:12681577-12681599 CCTTCGATCATCACGGAAGCAGG - Intergenic