ID: 1192591619

View in Genome Browser
Species Human (GRCh38)
Location X:72364769-72364791
Sequence TCTTATATGCATATATTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 3, 2: 7, 3: 56, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192591619 Original CRISPR TCTTATATGCATATATTGCA TGG (reversed) Intronic
906781562 1:48577232-48577254 TATTATATGCATAAGTTGAAGGG + Intronic
906870136 1:49470337-49470359 TCTTATAGGAATATTTTACAAGG - Intronic
907196914 1:52694497-52694519 TGTTACATGGATATATTGCCTGG - Intronic
907866956 1:58407730-58407752 TCTGATAGGAAGATATTGCAGGG - Intronic
908222152 1:62018123-62018145 TCTTATTTGCTTATGTTTCATGG + Intronic
908276211 1:62474087-62474109 TCTTATTTTCTTATTTTGCAGGG - Exonic
908729008 1:67207248-67207270 TGTTACCTGGATATATTGCATGG + Intronic
909189098 1:72529811-72529833 TCTTATATGGCTATGTTTCATGG - Intergenic
909239776 1:73197540-73197562 ACATATATCCATATATTGAAAGG + Intergenic
909648450 1:77944015-77944037 TTTTTTATACATATATTACATGG - Intergenic
910244677 1:85125741-85125763 TCTCTTATGCATATATTGGAGGG + Intronic
911030855 1:93486239-93486261 TCTCATATACCTTTATTGCACGG + Intronic
911444971 1:97981310-97981332 ACTTTTATGAATATATTACAAGG - Intergenic
912613070 1:111068327-111068349 TGTTACATGTATAAATTGCATGG + Intergenic
912674563 1:111666370-111666392 TAATATATGCACATGTTGCATGG - Intronic
912890866 1:113528862-113528884 TCTTATTGGCATATATTCTAAGG - Intronic
913000324 1:114573756-114573778 TTATATATCTATATATTGCAAGG - Intronic
913125892 1:115790003-115790025 TCTTCTATGCATATATTCAGTGG - Intergenic
913428958 1:118767682-118767704 TCTTAAATGCAAATATTGTTGGG + Intergenic
914795593 1:150917632-150917654 TGTAATATATATATATTGCAGGG + Intergenic
914831069 1:151171374-151171396 TCTTACATGCACCTGTTGCATGG - Intronic
915303140 1:154962801-154962823 TTTTATATGCATATATTTTAGGG - Exonic
916895439 1:169157488-169157510 TGTGGTATGCATGTATTGCATGG - Intronic
919000122 1:191820437-191820459 ATTTATATGCCTATAGTGCATGG - Intergenic
919545721 1:198915736-198915758 TCTTTTATGCATATATTTATGGG + Intergenic
919684689 1:200472964-200472986 CCTTGTATGGATCTATTGCAAGG - Intergenic
921999661 1:221463370-221463392 TGTTATATTCTTATATTTCAAGG + Intergenic
922131034 1:222778845-222778867 TATTCTGTGCATATATTGCCAGG + Intergenic
922433608 1:225581469-225581491 TCTTATATTTTTATTTTGCAAGG + Intronic
923176413 1:231470742-231470764 ACTAATCTGCACATATTGCAGGG - Intergenic
923579296 1:235192433-235192455 TCCTACATGCAAATAGTGCATGG - Intronic
924022249 1:239796738-239796760 TGTTACATGGATATATTGCATGG + Intronic
924498648 1:244614835-244614857 TTTTACATGCATATATTACATGG - Intronic
1063494687 10:6495897-6495919 TCTTCTATGCCTATATTACCTGG - Intronic
1064393887 10:14964542-14964564 TCTTATATACATATATATAAAGG - Intronic
1064619101 10:17196440-17196462 TCTTATTTGCATATATTTGCAGG + Intronic
1064920586 10:20513098-20513120 TCTTACATTCATATATTGCACGG + Intergenic
1064921237 10:20521143-20521165 TGTTGCATGCATAGATTGCATGG - Intergenic
1065415395 10:25479758-25479780 TCTTAAATCTATATATTGAAAGG - Intronic
1066023847 10:31331634-31331656 TCTTATATGCATAGAGGGGATGG + Intronic
1066701658 10:38135994-38136016 TCTCTTTAGCATATATTGCAGGG + Intergenic
1068180285 10:53509538-53509560 TGTTACATGGATATATTGCACGG + Intergenic
1069283329 10:66682718-66682740 TGTTATATGGGTATATTTCATGG + Intronic
1070924032 10:80206311-80206333 CCATATATGCATATATTACCTGG - Intergenic
1071368867 10:84930296-84930318 TCCTTTATACATATTTTGCATGG - Intergenic
1071752921 10:88502070-88502092 TCTTGTATGGATTTATAGCAAGG - Intronic
1074048741 10:109863516-109863538 TCCTATAAGCATTTCTTGCAGGG - Intergenic
1074216564 10:111390488-111390510 TCTTCTCTGTATATATAGCAGGG + Intergenic
1074607941 10:114993043-114993065 TATTCTATGCTTATATTTCAGGG - Intergenic
1075011898 10:118879097-118879119 TCTTGTATGTATATTTTGCTTGG - Intergenic
1077257176 11:1591296-1591318 TCTTATATTCATACATTCAATGG + Intergenic
1077984389 11:7336246-7336268 TGTTAGATGCATAGTTTGCAAGG + Intronic
1078129675 11:8602877-8602899 TCTTACATGCATTTATTGTGTGG - Intergenic
1080207336 11:29745349-29745371 TATTATATGCATATATTGATAGG + Intergenic
1080919213 11:36692086-36692108 TCTGACATGGAAATATTGCAGGG - Intergenic
1083515136 11:63250436-63250458 TCTTGTCTGCAAAGATTGCATGG - Intronic
1084638253 11:70407720-70407742 TCTTATATTCATTTACTGCATGG - Intronic
1087849816 11:103015438-103015460 TCTTGCATGCATATATTGCATGG + Intergenic
1087936530 11:104039846-104039868 TCTTATTTGCATATATCACATGG + Intronic
1088134861 11:106542782-106542804 TCTTATATGCTTATATTCTCAGG + Intergenic
1088881800 11:113978664-113978686 TCTAATATACATATAATGCCGGG - Intronic
1089070878 11:115698666-115698688 TGTTACATGGGTATATTGCATGG + Intergenic
1090989770 11:131805801-131805823 TCTTATATACTTGTATTGCTTGG + Intronic
1091186393 11:133651434-133651456 TTTTACATGGATATATTGCATGG + Intergenic
1092115017 12:5994319-5994341 TCTTGGATGCTTATATTTCAGGG - Intronic
1092150259 12:6243076-6243098 TATTATATGCATATTTCACAAGG + Intergenic
1092734424 12:11566989-11567011 TGTTATATGGACATACTGCATGG + Intergenic
1093138590 12:15480048-15480070 CCAAATATGCCTATATTGCAAGG + Intronic
1093231517 12:16549554-16549576 TCTGTAATGCATATATTGGAAGG + Intronic
1095378665 12:41562236-41562258 TCTTATATGTATTTAGTGCAAGG - Intronic
1095382198 12:41608642-41608664 TGTTACATGGATATATTGCGTGG - Intergenic
1095784988 12:46100422-46100444 TTGTTTATGCATATCTTGCAGGG - Intergenic
1097110326 12:56653181-56653203 TTTCATATACATATAATGCAGGG + Intergenic
1097640977 12:62181797-62181819 TCTTATCTTCATATATTAGAAGG - Intronic
1097721123 12:63022747-63022769 TCTCATGTACATATAATGCAGGG - Intergenic
1098630366 12:72714625-72714647 TCTTATAGGAATAAATTGTAAGG - Intergenic
1099277923 12:80601761-80601783 TCTTATATTTATATTTTTCAAGG + Intronic
1099751248 12:86775842-86775864 TATTATATATATATATTTCAGGG - Intronic
1099963015 12:89414823-89414845 TCTTAGATGCATAGAATTCATGG + Intergenic
1100741484 12:97598129-97598151 TCTTATCTTCATATATGACAAGG - Intergenic
1101157250 12:101939479-101939501 TTTTATATGAATTTCTTGCAGGG - Intronic
1101939269 12:109087710-109087732 GCTTATAACCATATATTCCAAGG - Exonic
1102411806 12:112726409-112726431 TCTTACATGCATATATTATCTGG + Intronic
1102822613 12:115921156-115921178 TCTCATCTGCATATATTACCAGG - Intergenic
1105250478 13:18694736-18694758 TATAATATGAATATATGGCAAGG + Intergenic
1108709289 13:53017103-53017125 TTTTATATGCAAATATTCCCAGG - Intergenic
1108811465 13:54229719-54229741 TTTTATATTCATATTTTCCAGGG + Intergenic
1108998056 13:56760224-56760246 TATTATATGGATATAGTGCCTGG - Intergenic
1109107205 13:58268407-58268429 ACTTATTAGGATATATTGCATGG - Intergenic
1109332468 13:60946501-60946523 TGTTACATGCATCTATTGCATGG + Intergenic
1109948191 13:69465702-69465724 TTTAAAATGCATATATTGAATGG - Intergenic
1109985019 13:69969189-69969211 TCTTAAATGCATGAATTACATGG - Intronic
1110579410 13:77102181-77102203 TACTATATGCATATATCACATGG + Intronic
1111495394 13:89042344-89042366 TCTTATCTTCATATATGGTAGGG + Intergenic
1112568670 13:100573314-100573336 ACATATATGCACATATTTCATGG - Intronic
1113059260 13:106303604-106303626 TGCTATATGCATAGATTGCATGG - Intergenic
1114195655 14:20473912-20473934 TGTTATATGGATATACTGCGTGG + Intronic
1114395672 14:22358189-22358211 TGTTACATGGATGTATTGCATGG + Intergenic
1116180999 14:41535516-41535538 TGTTATTTGTCTATATTGCATGG + Intergenic
1116672907 14:47866298-47866320 ACTTATTTGCATATATTAAAGGG + Intergenic
1120093347 14:80359526-80359548 TGTTATGTGGATATATTGCGTGG + Intronic
1122005704 14:98701803-98701825 TGTTACATGGATATATTGCATGG + Intergenic
1126714271 15:51497644-51497666 TCTTTTATGCACATAGTTCAGGG - Intronic
1127673970 15:61222888-61222910 TCTTACATAGATATATTGAAGGG - Intronic
1128363443 15:66979496-66979518 TGTTACAAGCATATATTGCATGG + Intergenic
1129293151 15:74584085-74584107 TTTTACATGGATATACTGCAGGG + Intronic
1130399671 15:83537735-83537757 TCTACTATGCATATATTGGTTGG + Intronic
1131665661 15:94568703-94568725 TTATATAGGTATATATTGCATGG - Intergenic
1131917397 15:97284037-97284059 TGTAACATGGATATATTGCATGG + Intergenic
1135615754 16:23909510-23909532 TATTACATGGGTATATTGCATGG + Intronic
1137357670 16:47782272-47782294 TGTTATGTGGATAAATTGCATGG + Intergenic
1138324582 16:56153655-56153677 CCTTGCATGCATATATTGTATGG + Intergenic
1138792678 16:59925866-59925888 TCTTATTTGCATTTCTTTCATGG - Intergenic
1140599447 16:76457841-76457863 TGTTACATGGGTATATTGCATGG + Intronic
1140627975 16:76817738-76817760 TGTTACATGCATATATTGCCTGG + Intergenic
1141165095 16:81655041-81655063 TCTCATATGCATAAAGTGCTTGG + Intronic
1141863560 16:86734435-86734457 TCTGAAATTCAAATATTGCATGG + Intergenic
1142543143 17:677614-677636 TATTATATACATATTTTACAAGG + Intronic
1143680366 17:8471717-8471739 TCTTATATGAAGCTATTGAAAGG - Intronic
1144466384 17:15500846-15500868 AATAATAAGCATATATTGCATGG - Intronic
1147972571 17:44227476-44227498 TTTTATATGCATATATTTTAGGG - Intergenic
1148518006 17:48240291-48240313 TCTTATTATCATATATTTCAAGG - Intronic
1149322893 17:55499396-55499418 TCTTACATGGATAAACTGCATGG + Intergenic
1149919208 17:60640582-60640604 TGTTACATGGGTATATTGCATGG + Intronic
1150013120 17:61524843-61524865 TCCTATTTCCAGATATTGCATGG - Intergenic
1154438372 18:14364190-14364212 TATAATATGAATATATGGCAAGG - Intergenic
1155125020 18:22865787-22865809 TCCTTTAAGCATATGTTGCAGGG + Intronic
1155230472 18:23769088-23769110 TGTTAGCTGGATATATTGCATGG - Intronic
1155292838 18:24358520-24358542 AATTATATGTATATATTTCAAGG + Intronic
1155704097 18:28786222-28786244 TTTTATATACATATATCTCAAGG + Intergenic
1155776030 18:29762764-29762786 TCTTATATGAATACATGGCCTGG + Intergenic
1156902392 18:42315713-42315735 TCTTATATGCATAATGTCCAGGG - Intergenic
1159761991 18:72438534-72438556 TGTTACATGCATATATTGCATGG + Intergenic
1162597305 19:11639526-11639548 TCTTAAATGCAGATATTCCCCGG + Intergenic
1163376288 19:16933158-16933180 ACTTTGATGCATATCTTGCATGG + Intronic
1164973105 19:32549364-32549386 TCATATATGCATTCATTTCAAGG - Intergenic
1167614844 19:50526810-50526832 TTTTCTATGCATATTATGCAGGG + Intronic
925665345 2:6248788-6248810 TCAAATATGCATATATCTCAGGG + Intergenic
927069604 2:19513298-19513320 TCTTCTATGCTGATTTTGCAAGG + Intergenic
927323887 2:21780752-21780774 TAATCAATGCATATATTGCATGG - Intergenic
928192801 2:29188893-29188915 TCTAATATGTAAATATTGTAGGG + Intronic
929048188 2:37811211-37811233 TGTTATGTGGATATGTTGCATGG + Intergenic
929388884 2:41444639-41444661 TGTTATATGCATAAATAGGATGG + Intergenic
929677803 2:43955101-43955123 TATAATATGCATCTTTTGCAGGG + Intronic
930525710 2:52526706-52526728 TTTAATATTCATTTATTGCATGG + Intergenic
932967724 2:76497177-76497199 CATTATATGCAGATATTTCAGGG - Intergenic
933644905 2:84803399-84803421 TGTTACACGGATATATTGCATGG - Intronic
934930389 2:98417505-98417527 TGTTACATGCATAGATTGCATGG - Intergenic
935405722 2:102707200-102707222 TGTTACATGGGTATATTGCATGG - Intronic
938809629 2:134841178-134841200 TCTTATCTGCATATTTCACAAGG - Intronic
939472346 2:142639568-142639590 TCTTACATGCATATATTGTGTGG + Intergenic
939579324 2:143929803-143929825 TCATATATGCATAAACTGCAGGG - Intergenic
940024007 2:149185895-149185917 CCTTATATGGGTATATTTCATGG - Intronic
941019116 2:160389286-160389308 TATTTCATGCATATTTTGCAGGG - Intronic
941157533 2:161997754-161997776 TATTTTACGCAAATATTGCAAGG - Intronic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
942433562 2:175944672-175944694 CCTTGTATCCCTATATTGCAGGG - Intronic
942960366 2:181823017-181823039 TGTTACATGCACAGATTGCATGG + Intergenic
943027564 2:182648136-182648158 TGTTATATGCACAGATTGCCAGG - Intergenic
943081928 2:183266510-183266532 TGTTATAAGGGTATATTGCATGG + Intergenic
944848873 2:203696595-203696617 TCTTACATGCATATATTGCATGG + Intergenic
944900561 2:204209909-204209931 TGTTACATGAATAAATTGCATGG - Intergenic
945738735 2:213634936-213634958 TCATATATATATATATTCCATGG + Intronic
1169246267 20:4027648-4027670 TGTTACATGGATATATTGCATGG + Intergenic
1169697764 20:8410094-8410116 CATTATATGCATATATTGTTGGG + Intronic
1169719133 20:8654039-8654061 TTTCATATGCATATATTGGGGGG + Intronic
1171286367 20:23942198-23942220 TCTTACATGCATACATTGTGTGG - Intergenic
1172853894 20:37986401-37986423 TTTTATGTGGATATCTTGCAGGG - Intronic
1173187555 20:40852527-40852549 CCTTATAGGCATGAATTGCAAGG + Intergenic
1174249120 20:49205311-49205333 TATTATATCCACATATTGCCTGG + Intergenic
1174873841 20:54207541-54207563 TATTACATGGATATACTGCATGG - Intergenic
1176457308 21:6925281-6925303 TATAATATGAATATATGGCAAGG + Intergenic
1176835481 21:13790365-13790387 TATAATATGAATATATGGCAAGG + Intergenic
1176938698 21:14898164-14898186 TCTTATATGAGTTTATTTCATGG - Intergenic
1177286296 21:19055685-19055707 TCTTATATGAGCATATTTCATGG - Intergenic
1177352814 21:19966256-19966278 TCTTATTTGCAAATATTTTAAGG + Intergenic
1177543324 21:22523642-22523664 TGTTACATGGATATATTACATGG - Intergenic
1181412260 22:22732357-22732379 TCTTATATATATACTTTGCATGG - Intergenic
1181415687 22:22757106-22757128 TCTTATATATATACTTTGCATGG - Intronic
1182988096 22:34740138-34740160 TCTTGTAAGCATATATATCATGG + Intergenic
1183065626 22:35360809-35360831 TGTTACATGGATATATTGCCTGG + Intergenic
1184375670 22:44110894-44110916 TCTTAAATGCATATATAGGCCGG - Intronic
949143599 3:666857-666879 TCTTCTAAGCATATAATGAAAGG - Intergenic
949279468 3:2329232-2329254 TCCTATATGTCTATATTTCATGG + Intronic
949705568 3:6812993-6813015 TATTATATGCATATATTAAGAGG + Intronic
951142814 3:19186470-19186492 TCTTTTATTCATATATTGAAAGG + Intronic
951634600 3:24759373-24759395 TCATATAATCATCTATTGCAGGG - Intergenic
952022834 3:29043403-29043425 TCTTATATGCACCTTTGGCAAGG + Intergenic
952300414 3:32099867-32099889 TCTTAGATGCTTATATTTAAAGG - Intergenic
953601520 3:44370684-44370706 TTTTTTATGCTTATATTGAAGGG + Intronic
953897466 3:46813098-46813120 TTTTATATGCATATATTTTAGGG + Intergenic
957173060 3:76764951-76764973 TATTATGTGCATATATTGTGTGG + Intronic
957485479 3:80856855-80856877 TGTTAAATACATATATTTCAAGG + Intergenic
957613834 3:82503968-82503990 CCTTATCTGCATATATTTAATGG + Intergenic
957798521 3:85043854-85043876 TCATATATACTTCTATTGCATGG - Intronic
959554689 3:107703115-107703137 TATTATATGCACTTATTACATGG - Intronic
960345009 3:116520232-116520254 TCTAATATGCAGAAATTACAAGG - Intronic
961345812 3:126262727-126262749 GCCTAAATGCATATTTTGCAGGG + Intergenic
961563184 3:127745634-127745656 TGTTACATGGATATATTGCGTGG - Intronic
964287439 3:155134180-155134202 TGTTACATGGATATATTGCATGG + Intronic
964523205 3:157589034-157589056 TGTTACATGAATATATTGCATGG - Intronic
965437897 3:168675087-168675109 TCTAATTTGCATACATTGGATGG + Intergenic
967794711 3:193587421-193587443 TCTCATAAGAATATATTGGATGG + Intronic
970876148 4:20872457-20872479 TTTTATCTGCTTAGATTGCAGGG - Intronic
971007073 4:22387258-22387280 AGTTATATATATATATTGCATGG - Intronic
971012358 4:22452345-22452367 TGTTACAGGCATAGATTGCATGG - Intronic
971535763 4:27749071-27749093 TTCAATATGCACATATTGCAAGG + Intergenic
971985223 4:33813387-33813409 TAACATATGCACATATTGCAGGG + Intergenic
972652102 4:41028166-41028188 ACTTAGAAGCATATATGGCATGG - Intronic
972748284 4:41962899-41962921 AATTATATGGATATATTGCTGGG + Intergenic
973170563 4:47137859-47137881 TTATATATACATATATTGGATGG - Intronic
973218654 4:47700476-47700498 TCTTTCAGGCATATTTTGCAGGG + Intronic
974518773 4:62953530-62953552 TGTTACATGTATATAATGCACGG - Intergenic
975363819 4:73504663-73504685 TGTTACATGTGTATATTGCATGG + Intergenic
975499830 4:75072501-75072523 TTTTATATGTGTTTATTGCAAGG - Intergenic
975756897 4:77580194-77580216 TGTTACATGCATAGATTGCATGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
975909697 4:79252284-79252306 TGTTACATGGATATATTGCTTGG - Intronic
976511455 4:85914361-85914383 TCTTAAAAGCACAGATTGCAGGG + Intronic
978233673 4:106431449-106431471 TTTTATATACAAATAATGCAAGG + Intergenic
978479370 4:109171764-109171786 TCTTATTTGCATGCATTTCAAGG - Intronic
978592171 4:110335944-110335966 TTTTATATGTCTATATGGCATGG + Intergenic
981269318 4:142826120-142826142 TCATATATGTATATATTTCATGG - Intronic
982914428 4:161188281-161188303 TTTTATATGGATTTATTGCAAGG - Intergenic
983711796 4:170726297-170726319 TGTTAGATGAATAGATTGCATGG - Intergenic
985474308 5:69790-69812 ATTTATATTAATATATTGCATGG + Intergenic
986121594 5:4842729-4842751 TCATATATGCATATAGTGCCTGG - Intergenic
986374225 5:7113933-7113955 TGTTACATGGATACATTGCATGG + Intergenic
986486260 5:8241521-8241543 TGTTCCATGCATATGTTGCATGG - Intergenic
987054317 5:14176909-14176931 TATTTTATGCACATATTACAGGG + Intronic
987127559 5:14828769-14828791 TCTGATTTGGATATAGTGCAAGG - Intronic
987964065 5:24849764-24849786 TATTATCTGCATATATTTCATGG + Intergenic
988365695 5:30295459-30295481 TTTTATTTACATATATTTCAAGG + Intergenic
988782429 5:34534526-34534548 TCATATATGTGTATATTACATGG + Intergenic
990969351 5:61486011-61486033 TGTTACATGCATAGATTTCATGG + Intronic
991194892 5:63921161-63921183 ACTTTTATGCTTATACTGCAGGG - Intergenic
991987014 5:72299209-72299231 TGTTACATGGGTATATTGCATGG - Intronic
992460035 5:76952421-76952443 TCTTATAGGCATTTCTTTCATGG - Intergenic
993322736 5:86494196-86494218 TGTTACATGGATATATTGCATGG + Intergenic
994785209 5:104151048-104151070 TATAATATGCACAGATTGCATGG - Intergenic
994996375 5:107068440-107068462 TCTTATTGCAATATATTGCAAGG + Intergenic
995099986 5:108288576-108288598 TGTTATATAAATATATTGGAAGG + Intronic
995242386 5:109899899-109899921 GGTTATATGCATATATAGAAAGG - Intergenic
995372351 5:111433168-111433190 TCTTATATTCATATATTCTTTGG + Intronic
995625326 5:114069984-114070006 TCTTATATGCATTCATTTCTGGG + Intergenic
995631452 5:114137586-114137608 TTTTATATGCAGAAATGGCATGG + Intergenic
995684878 5:114761501-114761523 TCTAATATCCAGAAATTGCAAGG - Intergenic
996007334 5:118437583-118437605 TGTTACATGCATATATTGCCTGG - Intergenic
998357599 5:141553669-141553691 TCTCAAATGCATATATGACAGGG + Intronic
999019506 5:148148049-148148071 TCTTATATGAAGATGTTGAAGGG - Intergenic
1000137160 5:158364001-158364023 TCGTATACACATATATAGCATGG + Intergenic
1001061343 5:168492125-168492147 TCTTAAATGACTATATTCCATGG + Intronic
1001825663 5:174743146-174743168 TGTTATGTGAGTATATTGCATGG - Intergenic
1002960094 6:1906217-1906239 GCTTATATGCATATGTAGGATGG - Intronic
1003108516 6:3233791-3233813 TCTTATAAGCTAATATTCCAAGG + Intronic
1004760579 6:18661637-18661659 TCTTATATCCAGAATTTGCAAGG + Intergenic
1005097125 6:22129266-22129288 TGTTATGTGCATTTATTGCATGG + Intergenic
1005178956 6:23081514-23081536 TATAATATGCATATATTATAGGG - Intergenic
1005961932 6:30700176-30700198 TCTTACATGCATGTATTAAATGG - Exonic
1006494288 6:34410436-34410458 TGTTATATGGATATATTACAGGG - Intronic
1008235517 6:49042900-49042922 TCTAATATGCAATTATTGCAAGG - Intergenic
1008297845 6:49799958-49799980 ACTTAAATGGATAGATTGCATGG + Intergenic
1008731386 6:54486732-54486754 TCTTATCTTCATATCTAGCATGG + Intergenic
1009532497 6:64837951-64837973 TGTTATATGCATATATTGCAAGG - Intronic
1009754128 6:67913126-67913148 TCTTGTGTTCATATATTGGAAGG - Intergenic
1009969663 6:70613545-70613567 GCTTGTATTCATGTATTGCAAGG + Intergenic
1010966780 6:82219324-82219346 CATTATAGGCATATATTGTAGGG - Intronic
1011987008 6:93459832-93459854 TCTCCTATGCCTATATTCCATGG + Intergenic
1015286518 6:131491512-131491534 TCAAATATGCATGTATTTCAGGG + Intergenic
1015444092 6:133283717-133283739 TGTTACGTGGATATATTGCATGG + Intronic
1017665184 6:156713207-156713229 TCTTATTTGTAAATATTTCAAGG - Intergenic
1018713917 6:166517066-166517088 TCTTATATTCAAATTTTGAAGGG + Intronic
1019113049 6:169733164-169733186 TCTAATATCCATAATTTGCAAGG - Intergenic
1020524000 7:9234730-9234752 TCTTATACGCACATATTTTATGG - Intergenic
1021695778 7:23274830-23274852 TCATATATTCATTTATTCCATGG + Exonic
1022667174 7:32422377-32422399 TGTTACCTGGATATATTGCATGG + Intergenic
1026996299 7:74619027-74619049 AGTTATGTCCATATATTGCAAGG + Intergenic
1027527360 7:79286892-79286914 TGTTATATGCATAGATTGCGTGG + Intronic
1027995179 7:85416801-85416823 TCTTATATATATATATTTCTGGG - Intergenic
1028295421 7:89123869-89123891 TCTTATATAAATATATTCCATGG - Intronic
1030184093 7:106742802-106742824 ACTTATTTGCTTATAGTGCATGG + Intergenic
1030549371 7:110938682-110938704 TGTTACATGGATATATTGCATGG - Intronic
1030649276 7:112099708-112099730 TCTTATATGCACATATTATGAGG - Intronic
1031296299 7:120009163-120009185 TTTTATATACATATATTGTCAGG + Intergenic
1031633735 7:124076663-124076685 TCTAATTTGCATTTATTCCAGGG - Intergenic
1032976105 7:137224943-137224965 TCTTATATTAATGTATTCCAAGG + Intergenic
1033836396 7:145317441-145317463 TCTTATATACTTATATAGAAAGG - Intergenic
1034507414 7:151504428-151504450 TCATATATGCAGATTCTGCAGGG - Intronic
1034516121 7:151581287-151581309 TATTCTAGGCATTTATTGCATGG + Intronic
1034742512 7:153490833-153490855 TCTGATATGCACATTTAGCAAGG + Intergenic
1034999208 7:155598167-155598189 TCTTAGATGCAAATTTTGCATGG - Intergenic
1036483418 8:9157873-9157895 CTTTATATACATATAATGCAAGG + Intronic
1037255996 8:16954379-16954401 TCTTACATGCACATATTGCCTGG - Intergenic
1037564243 8:20104227-20104249 TCTTATATACTTATCTTTCAAGG - Intergenic
1039719626 8:40149425-40149447 GCTTATATTCATAAATTTCAGGG + Intergenic
1040633361 8:49241714-49241736 TATTATTTGCATATGTTGCATGG + Intergenic
1041807906 8:61873759-61873781 TCTTATATTCATATATTGGCTGG + Intergenic
1043224892 8:77713701-77713723 TGCTACATGCATATATTGCATGG + Intergenic
1043665226 8:82802290-82802312 TCTTATTTGTATATATTTCAAGG + Intergenic
1043822672 8:84887881-84887903 TCTTATATGCATATATTTAAGGG + Intronic
1043925071 8:86027599-86027621 TGTTACATGGGTATATTGCATGG + Intronic
1044424504 8:92035441-92035463 TCTTACATGCATATATTGTGTGG - Intronic
1045745394 8:105413410-105413432 TTTTATATGTATATTTTGAAAGG + Intronic
1046033729 8:108815869-108815891 TTTTATTTTCATATATTTCAAGG + Intergenic
1046089750 8:109487560-109487582 TCTTTTATAGATAAATTGCAAGG - Intronic
1046111529 8:109731647-109731669 TGTTACATGGATATATTGCATGG - Intergenic
1046286703 8:112102755-112102777 TGTTATATGGATACACTGCAAGG + Intergenic
1046287733 8:112116616-112116638 TGTTACATGGATATATGGCATGG - Intergenic
1046721715 8:117627529-117627551 TCTAATAAGAATATAATGCAAGG + Intergenic
1046817754 8:118603838-118603860 TAATATATGAATATATTGGAAGG + Intronic
1047980677 8:130178445-130178467 TTTTGTTTGCCTATATTGCAGGG - Intronic
1048077271 8:131085324-131085346 GCTTATAAATATATATTGCAAGG - Intergenic
1048102020 8:131362644-131362666 TGTTACATGGATATATTGCATGG - Intergenic
1048940198 8:139393857-139393879 TGTTATATGGATATATTGTGTGG - Intergenic
1050153840 9:2644575-2644597 TTTTATAGGTATATATTTCAGGG - Intronic
1050349601 9:4728005-4728027 TCTTATATGGGTATAGTTCATGG + Intronic
1053258606 9:36641291-36641313 TCTATGTTGCATATATTGCAGGG + Intronic
1054345463 9:63910285-63910307 TCTTATCTGTATATATTCAAAGG - Intergenic
1055173610 9:73290565-73290587 TGTTCAATGCATATATGGCATGG - Intergenic
1056451176 9:86718207-86718229 TCTTATATGAATATATTTTATGG + Intergenic
1058665797 9:107314241-107314263 TCTTACATGCATATATTATGTGG + Intronic
1059223604 9:112650352-112650374 TCTCATAACAATATATTGCAAGG + Intronic
1059377215 9:113892604-113892626 CCACTTATGCATATATTGCATGG - Intronic
1059509637 9:114832550-114832572 TGTTATAAGCATTTATTGCATGG + Intergenic
1059864813 9:118502502-118502524 TGTTACATGCATATATTGCATGG + Intergenic
1185884030 X:3766103-3766125 TGTTACATGGATATATTGCATGG + Intergenic
1185914162 X:4016890-4016912 TATTACATGCATGGATTGCATGG + Intergenic
1185938134 X:4282160-4282182 TTTTACATGGATATATTGCATGG + Intergenic
1186029722 X:5354609-5354631 TGCTACATGCATATATTGCATGG + Intergenic
1186079514 X:5915270-5915292 TCTTTTATGAAAATACTGCAAGG - Intronic
1187058231 X:15761232-15761254 TGTTACATGGGTATATTGCATGG + Intronic
1187114885 X:16339350-16339372 TGTTACATGGGTATATTGCATGG + Intergenic
1187855447 X:23632455-23632477 TCTTACATGCATATATTGCATGG + Intergenic
1188261378 X:28028919-28028941 TCATATATACATATATAGAAAGG + Intergenic
1188333883 X:28903763-28903785 ACCTATATGCATATATTCTATGG + Intronic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1191741046 X:64435142-64435164 TTTTATATGCATATATTTTAGGG + Intergenic
1192045319 X:67665833-67665855 CATTTTATGCATATATTCCATGG - Intronic
1192591619 X:72364769-72364791 TCTTATATGCATATATTGCATGG - Intronic
1193113068 X:77749002-77749024 TCGTACATGCATATATTGCATGG + Intronic
1193342718 X:80369773-80369795 TCTTATATGCAAGTTTGGCAGGG + Intronic
1193864703 X:86717128-86717150 TGTCATATGCATAGATTGCATGG + Intronic
1194582470 X:95693213-95693235 GCTTAGCTGCATATATTACAGGG - Intergenic
1194896598 X:99449082-99449104 TGTTATATAGATATATTGAATGG - Intergenic
1196219394 X:113094661-113094683 TCATATATGCATATATGCAAAGG + Intergenic
1196355774 X:114790387-114790409 TGTTATATGCATATGTTTGAAGG + Intronic
1196504768 X:116428398-116428420 TCTTATATGAACATAGTTCATGG - Intergenic
1196529352 X:116766190-116766212 TGTTACATGGATATATTGCATGG + Intergenic
1196672394 X:118382686-118382708 TCTTATAACCAAATACTGCAGGG + Intronic
1197015763 X:121624561-121624583 TCTTATTTGCATAAATTTAAGGG + Intergenic
1197623319 X:128776806-128776828 TTTTTTATGTATCTATTGCATGG + Intergenic
1198373114 X:136011168-136011190 TATGACATGGATATATTGCATGG - Intronic
1198507933 X:137319604-137319626 TGACATATGGATATATTGCAAGG - Intergenic
1198527929 X:137521009-137521031 TCCTATTTGCATCTATTGCAAGG - Intergenic
1200781339 Y:7218836-7218858 TGTTACATGGATATATTGCATGG - Intergenic