ID: 1192592127

View in Genome Browser
Species Human (GRCh38)
Location X:72369048-72369070
Sequence TGAGAACCAAACTGAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 222}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192592127_1192592128 -2 Left 1192592127 X:72369048-72369070 CCAGGCTCTCAGTTTGGTTCTCA 0: 1
1: 0
2: 1
3: 26
4: 222
Right 1192592128 X:72369069-72369091 CACAGCACGAAAACACGAGTTGG 0: 1
1: 0
2: 0
3: 1
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192592127 Original CRISPR TGAGAACCAAACTGAGAGCC TGG (reversed) Intronic
900393121 1:2442453-2442475 TGGGCACCAAGCTGGGAGCCAGG - Intronic
902251418 1:15156111-15156133 TGAGGCCCAAACTGCCAGCCTGG + Intronic
902934316 1:19753715-19753737 GCAGAATCAAACTGAGAGCCAGG + Intronic
906153565 1:43601417-43601439 TGAGTGCCAAGCTCAGAGCCTGG - Intronic
906415419 1:45618063-45618085 TGAGAATCAGGCTGAAAGCCGGG + Exonic
906853390 1:49278302-49278324 TGAGAAGCAAATTGAAAGCATGG - Intronic
907046285 1:51302213-51302235 AGAGAACCAACCAGAGAGCAGGG - Intronic
907308654 1:53527328-53527350 CGAGCCCCACACTGAGAGCCTGG + Intronic
908412093 1:63877145-63877167 TATGAACAAAACTGAAAGCCAGG - Intronic
909800499 1:79801815-79801837 AGATAACTAAACTGAGAGCCAGG - Intergenic
909832557 1:80211146-80211168 TGAGAAGAAAATTGAGAGCTTGG + Intergenic
910451686 1:87353103-87353125 TAAGCACCAAACTGGGAGTCAGG + Intergenic
910554706 1:88518634-88518656 GGAGAACCAAACTGAGACATAGG - Intergenic
910703256 1:90100103-90100125 TGAGAATAAAACTGAGTGGCTGG + Intergenic
913216740 1:116627345-116627367 TGGGGACCAGACTGAGAGTCTGG - Intronic
913362099 1:117992617-117992639 TGAGTACCAAACGGAGGTCCTGG + Exonic
914228229 1:145739968-145739990 TGAGAATCAAAATGAGAGTCTGG + Exonic
915120032 1:153624361-153624383 TGAGAAGAAAACAGTGAGCCAGG + Intronic
916800373 1:168210222-168210244 TGAGAACCTGATTGAGTGCCTGG - Intergenic
918988734 1:191668766-191668788 TGAAAACAAAACAGAAAGCCTGG + Intergenic
919474557 1:198018098-198018120 TCAGACCCAAAGTAAGAGCCTGG - Intergenic
919831342 1:201542165-201542187 TGAGCCCTAAACTGAAAGCCAGG - Intergenic
920205406 1:204287497-204287519 TGAGAACAAAACTGAAATCCAGG - Intronic
920712123 1:208305182-208305204 TGAGAACTAAACAGAAAACCTGG + Intergenic
920889478 1:209969772-209969794 TCAGAACCACAATGAGGGCCAGG - Intronic
921465891 1:215487239-215487261 TGAGATCCTAACTGAGACACAGG - Intergenic
922086863 1:222357481-222357503 TGAGATTCAAACTGCGAGGCGGG + Intergenic
923109742 1:230881106-230881128 TGAGAATAAAACTCAGAGGCTGG + Intergenic
924106226 1:240651908-240651930 TGAGACCCAAACTGATAGCAAGG - Intergenic
1063035521 10:2283226-2283248 AGAGAACCAGACTGGCAGCCTGG + Intergenic
1064408024 10:15081696-15081718 CGTGGACCAAGCTGAGAGCCCGG - Intronic
1065432682 10:25675234-25675256 TGAGACCCAAACAGAGAGCCTGG + Intergenic
1069249167 10:66246172-66246194 TGGGCACCACACTGAGAGCAGGG + Intronic
1070312138 10:75281643-75281665 TGGGTATCAAAATGAGAGCCTGG - Intergenic
1071099968 10:82024624-82024646 TGAGCACTAGACTGAGATCCAGG + Intronic
1071555731 10:86599983-86600005 TGAGATTCAAACTGCGAGGCAGG + Intergenic
1072170919 10:92860962-92860984 TGAGAACAAACCTCAGAGACTGG - Intronic
1073006469 10:100329280-100329302 TGAGAACACAGCTGAGAACCGGG - Exonic
1073263467 10:102208143-102208165 TGAGAACTTTTCTGAGAGCCAGG - Intergenic
1073862887 10:107767595-107767617 TGAGCAACAAAGTGAGACCCTGG + Intergenic
1074364086 10:112844338-112844360 TGAGAACCAAACATGAAGCCTGG + Intergenic
1074483454 10:113850435-113850457 TCAGAACCAAACTGATAACTCGG - Exonic
1075739294 10:124684091-124684113 TGAGATACAAACTGAGGGGCTGG + Intronic
1080498670 11:32847408-32847430 TCAAAACCACAGTGAGAGCCAGG + Intronic
1080634149 11:34108637-34108659 TGGAAACTAAACTGAGGGCCAGG - Intronic
1083256334 11:61498374-61498396 TGAGAATAAAACTTAGAGCCCGG + Intergenic
1083969069 11:66061567-66061589 TGAGAATCAGAGTGGGAGCCAGG + Intronic
1085307527 11:75496391-75496413 TGAGCAGGAGACTGAGAGCCAGG + Intronic
1087479294 11:98679800-98679822 TGAGAACCAAACTGAGCTTCTGG - Intergenic
1088342767 11:108787985-108788007 TAAGAACCAAACTGAGCTTCTGG - Intronic
1089093443 11:115897933-115897955 TGACAGCTAAACTGAAAGCCTGG - Intergenic
1089777899 11:120851719-120851741 TGGGAACCTATCTGAGAGCCTGG + Intronic
1089835830 11:121369813-121369835 TGGGAACCAAAATGGGAGGCAGG + Intergenic
1089836455 11:121374650-121374672 TGGGAACCAAAATGGGAGGCAGG + Intergenic
1090447232 11:126774816-126774838 TGGCAACCAAGCTGACAGCCTGG + Intronic
1090956665 11:131519159-131519181 TGAGTTTCAAATTGAGAGCCAGG + Intronic
1091718866 12:2797888-2797910 TGAGATCCAGGCTAAGAGCCAGG + Intronic
1091720991 12:2813336-2813358 TGAGCACTAAACTGTGTGCCAGG - Intronic
1093506253 12:19870462-19870484 AGAGACCCTAACTGAGAGGCGGG - Intergenic
1094821794 12:34231857-34231879 TGAGACCCAAACTAAGGGTCAGG + Intergenic
1095315943 12:40761488-40761510 CCACAACCAAACTGAGAACCAGG - Intronic
1095357392 12:41291924-41291946 TGAGTACCAAACTGGGAGGAAGG + Intronic
1097338902 12:58415635-58415657 TGATAAGGAAACTGAGACCCAGG + Intergenic
1098390468 12:69964492-69964514 AGAGAACTAAACTCAGAGCCAGG + Intergenic
1099697845 12:86044195-86044217 TGAGAACAAAGCTGGGAGCCTGG - Intronic
1099709919 12:86210919-86210941 TTAGAAACAAACTGATAGCAAGG - Intronic
1100361169 12:93880895-93880917 TTAGAACCAAACTGAGTGAAAGG + Intronic
1101779634 12:107823885-107823907 TGGGAACATAACTGATAGCCCGG - Intergenic
1110551582 13:76816613-76816635 TCAGAGCCAAACTGACAGGCTGG + Intergenic
1112207555 13:97339643-97339665 TGAGAACCAAACTCAGACACCGG + Intronic
1114396005 14:22362403-22362425 TGAGAAGCTCACTGAGATCCAGG - Intergenic
1114895318 14:26982717-26982739 AGAGAACTGAACTGAGAGTCAGG - Intergenic
1115114042 14:29858201-29858223 AGAAAACCAAACTGAGATCAGGG - Intronic
1116307717 14:43279951-43279973 AGAGAAAAAAACTGATAGCCAGG - Intergenic
1117094823 14:52286135-52286157 TAGGAACCAAAATGAGAGGCAGG - Intergenic
1117920388 14:60722085-60722107 GGGGAAGCAAACTGGGAGCCGGG - Intronic
1118587161 14:67365279-67365301 TGGTAACCAAACTTAGAGACAGG + Intronic
1118823062 14:69357651-69357673 TCAGAAGCAACCTGAGAGCCAGG - Intergenic
1125725350 15:41865741-41865763 TGAAAATCCAACTGAGAGCAGGG - Intronic
1126337287 15:47600139-47600161 TGCAAAACAAACTGAGAACCAGG + Intronic
1127797359 15:62450135-62450157 TGAGACACACACTGAGAGGCCGG - Intronic
1130693039 15:86103130-86103152 AGAGAACCAAACAGAAATCCTGG - Intergenic
1132087737 15:98921903-98921925 GAAGAACCACTCTGAGAGCCGGG + Intronic
1132515589 16:364299-364321 TGAGAACTGAGCTGGGAGCCCGG - Intergenic
1135510883 16:23081887-23081909 TCAGATACAAACTAAGAGCCAGG + Intronic
1135887488 16:26324310-26324332 TGTGGACCAGATTGAGAGCCTGG + Intergenic
1136137381 16:28264870-28264892 TGGGAGGAAAACTGAGAGCCTGG + Intergenic
1137241086 16:46654992-46655014 TAAAAACCAAACTGTGGGCCAGG - Intergenic
1138712818 16:58987884-58987906 AGAGAACCAAACAGAAATCCTGG + Intergenic
1139766508 16:69234996-69235018 AAAGAACCAAGTTGAGAGCCGGG - Intronic
1142828051 17:2526721-2526743 AGGGAACCAAACTGGGACCCCGG - Intergenic
1143003230 17:3808986-3809008 TCAAAACCACAATGAGAGCCAGG + Intergenic
1143764657 17:9129629-9129651 TGAGAAGCAAACGGAGATTCAGG - Intronic
1148103102 17:45104691-45104713 TGAGAACCACCCGGAGAGCGGGG + Intronic
1148142054 17:45336026-45336048 TCAGAACAAAATTGAGAGCAGGG + Intergenic
1149140729 17:53429346-53429368 TGAGAACAAAACTGAGGACATGG - Intergenic
1149337834 17:55655434-55655456 TTAGCACCAAACAGAGTGCCTGG + Intergenic
1152311625 17:79554786-79554808 TCAGAACCTAACACAGAGCCTGG - Intergenic
1152444088 17:80330535-80330557 GGAGAACCACACTGAGAACACGG - Intronic
1153448448 18:5198838-5198860 TGAGAATCAGACTGAGACCCAGG + Intergenic
1153966915 18:10190567-10190589 TCAGAACCACACTGCGATCCTGG - Intergenic
1154970890 18:21408497-21408519 TCAAAACCATAATGAGAGCCAGG + Intronic
1157352404 18:46900476-46900498 TGGGAAACAAAGTGAGACCCAGG + Intronic
1158241930 18:55387284-55387306 TTAGACCCAAACTCTGAGCCAGG - Intronic
1159274098 18:66193420-66193442 AGAGAACAAAGCTGTGAGCCTGG - Intergenic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1162548865 19:11347245-11347267 TGAGCACCTAATTGAGTGCCGGG - Intronic
1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG + Intronic
1163275620 19:16282457-16282479 TGAGACCCAGACCGAGGGCCGGG + Intergenic
1163574664 19:18103661-18103683 TGAGTAGCAAGCTCAGAGCCTGG - Intronic
1163640897 19:18461422-18461444 TCAGAACCTGCCTGAGAGCCAGG - Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1168492189 19:56820523-56820545 TGGGAACCAAACCAAGGGCCAGG - Intronic
926236343 2:11047748-11047770 TGAGCACCTAGCTGAGAGCAGGG - Intergenic
928338566 2:30421357-30421379 TGAATACCAAACTCAGAGCCAGG - Intergenic
929315130 2:40467971-40467993 AGACAACCAAACTGAGATCTAGG - Intronic
930650656 2:53961277-53961299 TGAACACCAAACTGAGAGCATGG - Intronic
931464254 2:62473019-62473041 TAAGAACCAAACTCAGAGATGGG + Intergenic
932851210 2:75188835-75188857 TTGGAACCATACTAAGAGCCTGG + Intronic
933225019 2:79738126-79738148 TGAGTATAAAACTGAGACCCAGG - Intronic
934067840 2:88355708-88355730 TGGGAACCAGACAAAGAGCCAGG + Intergenic
934972482 2:98774549-98774571 TGAGACCCAAACCAAGAGCAAGG - Intergenic
938186216 2:129234318-129234340 GGAAAACAAAACAGAGAGCCAGG - Intergenic
938236151 2:129708701-129708723 GGAGAACCTACCTGGGAGCCTGG + Intergenic
939161975 2:138601598-138601620 TGAGAAACACACAGAGACCCAGG + Intergenic
940738724 2:157482515-157482537 TGAGAACCACTCTTAAAGCCTGG + Intronic
941224167 2:162824811-162824833 TGAGATGCAAACTGATGGCCAGG - Intronic
942091471 2:172495658-172495680 TGAGAACCAAAGTCAGGGACTGG - Intronic
942617633 2:177810640-177810662 TGAGAAGAGAAATGAGAGCCAGG + Intronic
942971795 2:181965626-181965648 ATGGAACCAAACTGAGAACCCGG - Intronic
947943162 2:234076274-234076296 TGAGACCCAGACTGGGACCCCGG - Intronic
1169972999 20:11290965-11290987 AGAGAACTAAATTGAGAGTCAGG + Intergenic
1172310153 20:33911842-33911864 TGAGAACCAAACAGAGCCCGGGG - Intergenic
1175541275 20:59749493-59749515 TGAGAGCCACACTGTCAGCCTGG - Intronic
1176933164 21:14837967-14837989 TGAGAACGAAACTGTGCTCCTGG + Intergenic
1178362188 21:31957949-31957971 TCACAGCCAAACTGTGAGCCAGG - Intronic
1180018819 21:45106364-45106386 TGATAAACACACTGAGAGCAAGG - Intronic
1180818096 22:18805725-18805747 TGGGGACCAGACTGAGAGTCTGG - Intergenic
1181204314 22:21240180-21240202 TGGGGACCAGACTGAGAGTCTGG - Intergenic
1182103418 22:27672628-27672650 TGAGCACCATTCTGACAGCCAGG + Intergenic
1183647746 22:39136244-39136266 TGAGAAAGAAACTGAGGCCCAGG - Intronic
1203222608 22_KI270731v1_random:55235-55257 TGGGGACCAGACTGAGAGTCTGG + Intergenic
949607970 3:5675347-5675369 TGAGAACAACACTGAGAGAATGG + Intergenic
950495055 3:13328787-13328809 TGAGGACCGAACTGTGAGCATGG + Exonic
950658214 3:14450463-14450485 TGAGTACCAAGCTGGCAGCCAGG - Intronic
953029660 3:39170473-39170495 TAAGAACTAAGGTGAGAGCCAGG - Intergenic
957856880 3:85890924-85890946 TGAGAAGTAAACAGAGAGGCAGG + Intronic
965377721 3:167946819-167946841 TGAGAACTGAAATGAGGGCCAGG + Intergenic
967258490 3:187618401-187618423 TGAGAACCTAACTATGTGCCAGG - Intergenic
967447386 3:189582851-189582873 TGAGCACTAAAATGAGAGTCAGG - Intergenic
968181920 3:196601727-196601749 TGAGCACCACACTGACAGGCCGG + Intergenic
968182966 3:196610734-196610756 AGATAACAAAACTGAGGGCCGGG - Intergenic
969162568 4:5274414-5274436 AGATAAACAAACTGAGAGACAGG + Intronic
970322257 4:14886347-14886369 AGAGAACCAGACTGCAAGCCTGG + Intergenic
970442091 4:16089953-16089975 AGAGAACTGGACTGAGAGCCAGG + Intergenic
970464182 4:16306624-16306646 TGATAAAGAAACTGAGGGCCAGG + Intergenic
970703623 4:18772240-18772262 AGAGAACCAAACTGAAATTCTGG + Intergenic
971007033 4:22386736-22386758 TGAGAACCACAGTGAGACTCAGG + Intronic
972259929 4:37397532-37397554 GGAGAACCAAGGTGAGAGCTGGG - Intronic
972346322 4:38195499-38195521 TGAGTACCAAGCTCAGTGCCAGG - Intergenic
975921397 4:79394607-79394629 TGAGAATCAATTTTAGAGCCCGG + Intergenic
979033298 4:115679032-115679054 TAAGAACCAAATTGGAAGCCAGG + Intergenic
982120061 4:152134504-152134526 TGAGAACCAAAATGGGAGTGGGG + Intergenic
982198722 4:152938965-152938987 TGAGCTCCAAACTGACGGCCAGG + Intronic
982208647 4:153017528-153017550 TGAGAACCAAAATGGGACACTGG + Intergenic
983033977 4:162839350-162839372 TGAGATCCAAACTGATAGGGTGG - Intergenic
983784999 4:171719119-171719141 AGAGAACAAAGCTGTGAGCCTGG + Intergenic
985386965 4:189458130-189458152 TAAAAACCTAACTCAGAGCCTGG + Intergenic
987012703 5:13783339-13783361 TGAGAACCACACAGAGAATCTGG - Intronic
988778266 5:34496529-34496551 TGAGAACCAAGCCGTGAGCTGGG - Intergenic
988994861 5:36705181-36705203 TGAGCAGCAACCTGGGAGCCAGG + Intergenic
989461810 5:41708427-41708449 TGGGAAAGAAACTAAGAGCCTGG - Intergenic
990948673 5:61275470-61275492 CTAGAACCAAGCTGAGACCCTGG - Intergenic
990990321 5:61677622-61677644 TGAGACCTCAACTGAGAGCCAGG - Intronic
993944200 5:94098011-94098033 AGAGAACAAAGCTGTGAGCCTGG + Intronic
994318506 5:98361472-98361494 TGATAACCAAACTGAGCATCAGG + Intergenic
995751957 5:115461347-115461369 GGGGAACAAAACTGAGACCCAGG - Intergenic
996497888 5:124182326-124182348 GGAGAATGAAACTGAGAGACAGG + Intergenic
997662560 5:135600620-135600642 TCAGAACCAAACACAGTGCCTGG + Intergenic
998386170 5:141758297-141758319 TGGGCACCAATCTTAGAGCCTGG + Intergenic
998487108 5:142512473-142512495 ACAGGACCAAAGTGAGAGCCTGG + Intergenic
1001519033 5:172377563-172377585 TCACAACCAAGCTGTGAGCCAGG + Intronic
1002348788 5:178567444-178567466 TAAGAACCAACCTGAAAGGCTGG + Intronic
1004878638 6:19983364-19983386 TGAGAAGGAAAATGAGAGCGAGG + Intergenic
1004893002 6:20119849-20119871 TGAGAACTAAAACCAGAGCCAGG + Intronic
1005030404 6:21503338-21503360 TGAGAATTAAAATGAGAGGCCGG - Intergenic
1005894933 6:30169980-30170002 TGAGGAAGAAACTGAGACCCAGG + Intronic
1007408726 6:41649392-41649414 TGAGCACTGAACTGAGAGTCAGG + Intronic
1007476311 6:42122186-42122208 TGAGAACCACCCTTAGACCCAGG + Intronic
1008008144 6:46434359-46434381 TGTGAAGCAAACTCAGAGACAGG + Intronic
1012429104 6:99145618-99145640 TGAGAACCAAAGTCAGGGCTGGG + Intergenic
1012446477 6:99312136-99312158 TGAGAGCCCAACTGAGTGCCTGG - Intronic
1013194971 6:107837080-107837102 GGAGAACAAGACTGAGAGTCAGG - Intergenic
1015362995 6:132362471-132362493 TAAGAACCAGACTGACAGTCTGG - Intronic
1016369168 6:143354085-143354107 TAAGAACCAAACAGAAATCCTGG - Intergenic
1017247853 6:152246431-152246453 GGAGAACCAAAGTGAGCTCCGGG + Intronic
1017305587 6:152914718-152914740 AGAGAACCAAGCTGTGTGCCTGG - Intergenic
1018320219 6:162600680-162600702 TGAGAACAACACTGAGAGGATGG - Intronic
1018334843 6:162776043-162776065 TGAGAAAAAAAATAAGAGCCTGG + Intronic
1018398395 6:163399132-163399154 TGAGTCCCAAAATGAGAGCATGG - Intergenic
1018546603 6:164943590-164943612 AGAGAACAGAACAGAGAGCCCGG + Intergenic
1022908786 7:34880415-34880437 TAAGAACCAAAATGAGAGGCAGG - Intergenic
1024564970 7:50673354-50673376 GTAGAATCAAGCTGAGAGCCAGG - Intronic
1024768423 7:52688547-52688569 TTAGAAACAAACTGTAAGCCAGG - Intergenic
1026198707 7:68195424-68195446 TAAGAATAAAACTGAGGGCCGGG - Intergenic
1028475442 7:91248574-91248596 TGAGTACCAAACAGAGTGCCTGG + Intergenic
1028924378 7:96341625-96341647 TGAGCAACATACTGAGACCCCGG + Intergenic
1029298372 7:99559103-99559125 TGAGGACCGAGCTGGGAGCCGGG + Intronic
1029478202 7:100797625-100797647 TGAGAACCAACCCCACAGCCCGG + Intronic
1029876811 7:103762957-103762979 TGAGAACCAAATTGAAGTCCTGG - Intronic
1030791175 7:113730874-113730896 AGAGAAGGAAACTGAGAACCAGG - Intergenic
1031174763 7:118336471-118336493 TGAGTACCAGACTTGGAGCCAGG - Intergenic
1034267112 7:149786382-149786404 TGAGAGCTAAGCTGACAGCCAGG + Intergenic
1034899698 7:154899945-154899967 TGATAACCAAAGTCAAAGCCAGG - Intergenic
1034910115 7:154989468-154989490 TGAGCACCAAAATGACAGCCTGG + Intronic
1035662931 8:1360853-1360875 TGAGATCCAGACAGAGACCCGGG + Intergenic
1036570463 8:9975734-9975756 TCAGAACCAATCTCAGGGCCAGG - Intergenic
1036710237 8:11073794-11073816 TGAGAAACAAACAGACAGACAGG + Intronic
1037874449 8:22533901-22533923 TTAAAACCACACTGAGGGCCGGG + Intronic
1039143990 8:34424444-34424466 AGAGAACTATAATGAGAGCCAGG - Intergenic
1041310436 8:56510918-56510940 TTAGGACCACACAGAGAGCCTGG + Intergenic
1041550064 8:59090629-59090651 TGAGGACCCAGCTGAGAGCAGGG - Intronic
1042575024 8:70208203-70208225 TGAGAGCCTAATTGAGAGCAAGG + Intronic
1044311157 8:90694389-90694411 TGTGAACCAAGCTGAGAAGCAGG + Intronic
1045534889 8:103018505-103018527 TGAAAACCAAGCAAAGAGCCAGG - Intergenic
1046820194 8:118626356-118626378 TGAGCCCCAAACTGTGAGCTAGG - Intergenic
1047229654 8:122985610-122985632 TGAGAACCAGGCTGAGAGCTGGG + Intergenic
1048649111 8:136454491-136454513 AGAGAAGAAAAATGAGAGCCAGG + Intergenic
1050314239 9:4384866-4384888 TGAGATCCAAACTGGGAACCTGG + Intergenic
1050877150 9:10652514-10652536 AAAGAACCAAACTGAAATCCTGG + Intergenic
1052363374 9:27584146-27584168 TGAGAACAAAACTGAGTCACAGG + Intergenic
1052817761 9:33114686-33114708 TGAGGACCAAAATGAAAGCCTGG + Intronic
1058674413 9:107388197-107388219 TGAGAAGGAAAATAAGAGCCAGG - Intergenic
1059787780 9:117605342-117605364 TAAAAACCAGACTGAGAGCTGGG + Intergenic
1060216718 9:121742879-121742901 TGAGGCTCAAACTGAAAGCCTGG + Intronic
1062189704 9:135241741-135241763 GGAGAAGCAAACAGAGAGACAGG - Intergenic
1185810152 X:3100893-3100915 AGAGAAAAAAACTGAGAGTCAGG - Intronic
1185843359 X:3414149-3414171 TGAGACCAGAAGTGAGAGCCAGG + Intergenic
1186868448 X:13745046-13745068 TGAGCACGAAACTGACAGACAGG - Intronic
1187272821 X:17794015-17794037 CAAGGACCAAACTGAGGGCCTGG + Intergenic
1188710014 X:33384719-33384741 GGAGCACCAGACTGACAGCCAGG - Intergenic
1189581381 X:42410699-42410721 TGAGAACCAAACTGAAAGAGAGG - Intergenic
1190513446 X:51197131-51197153 TTGGAACAGAACTGAGAGCCTGG - Intergenic
1192592127 X:72369048-72369070 TGAGAACCAAACTGAGAGCCTGG - Intronic
1192734739 X:73839505-73839527 TCTGAACCAAACTCAGAGCCAGG + Intergenic
1195142070 X:101971449-101971471 TGAGAACCAAAATGAACTCCAGG - Intergenic
1196070218 X:111512567-111512589 TGAGAACCAAACAGAGATCAGGG + Intergenic
1196070941 X:111521021-111521043 TGGGCACAAAAGTGAGAGCCTGG - Intergenic
1197019724 X:121672083-121672105 TGAGAACCTAATTAAAAGCCTGG + Intergenic
1198074969 X:133185355-133185377 TGGGATTCAAACTGAGAGGCAGG + Intergenic