ID: 1192594295

View in Genome Browser
Species Human (GRCh38)
Location X:72389905-72389927
Sequence CCCCCATGGTACCCTCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192594295 Original CRISPR CCCCCATGGTACCCTCAGCC TGG (reversed) Intronic
900108862 1:997416-997438 CCCTCTTGGGACCCACAGCCCGG + Intergenic
900148105 1:1167069-1167091 GTCCCATGCAACCCTCAGCCGGG + Intergenic
900479327 1:2890426-2890448 CCCCCGTGGGACCCACAGGCAGG - Intergenic
901647959 1:10726804-10726826 CCCCCATGCTAGCCTCTCCCTGG - Intronic
901670924 1:10856122-10856144 CTCCCCTGGGACCCCCAGCCTGG + Intergenic
903389773 1:22955458-22955480 CCACCATCCCACCCTCAGCCGGG - Intronic
904461008 1:30679805-30679827 CCCCCTTGGCACCTACAGCCTGG + Intergenic
904862045 1:33545909-33545931 CCCCATTTGAACCCTCAGCCTGG - Intronic
905004846 1:34701226-34701248 ACCCCAGGGAGCCCTCAGCCTGG + Intergenic
905659788 1:39712661-39712683 GCCCCATGGAACCCTCTTCCAGG + Intronic
909545050 1:76837269-76837291 CTCCCATGGCTCCCTCTGCCAGG - Intergenic
910324870 1:85995563-85995585 CCCCCATGGTACCCTGAGGAGGG + Intronic
912811604 1:112799264-112799286 CTCCCATGCTTCCATCAGCCTGG + Intergenic
912952210 1:114127856-114127878 CCCCCATGCTCCCCTGGGCCTGG - Intronic
913210109 1:116575422-116575444 CCACCATGCTCCCCTCAGCTGGG + Exonic
914343219 1:146777248-146777270 CTGCCATGGGATCCTCAGCCTGG + Intergenic
915313643 1:155016655-155016677 ACTCCATGGCACCTTCAGCCTGG - Exonic
919762133 1:201104798-201104820 CCACATTGGTCCCCTCAGCCTGG + Intronic
921934609 1:220785584-220785606 CAGCCATGGTCCCCTGAGCCAGG - Intergenic
1062976587 10:1688243-1688265 ACCTCATGGTGCACTCAGCCTGG + Intronic
1063387718 10:5626538-5626560 CCCACATGGCACCAGCAGCCAGG + Intergenic
1063420852 10:5911566-5911588 CCCCGATGGTTTCCTCAGCAGGG + Intronic
1067688266 10:48480959-48480981 CCGCTGTGGTGCCCTCAGCCAGG - Intronic
1071016415 10:81002238-81002260 TACACATGGAACCCTCAGCCTGG + Intergenic
1071417354 10:85453790-85453812 CCCCCATGCAATCCTGAGCCGGG + Intergenic
1072674685 10:97457001-97457023 CCTGCATGGTACCCTAAGGCAGG - Exonic
1073470212 10:103717471-103717493 GCCCCATGGTTCCCTCCACCAGG - Intronic
1076606125 10:131691115-131691137 CCCCCAGGGCACCCTCAGTGGGG - Intergenic
1076786209 10:132751321-132751343 CCCACATGGCCCCATCAGCCTGG + Intronic
1077077814 11:709218-709240 CCCCCAAGGGACCCCCACCCAGG + Intronic
1077366977 11:2165185-2165207 CCCCCATGGTGCCCCCAAACTGG - Intronic
1078642708 11:13111248-13111270 CCGCCATTGTTCCCTCAGTCAGG - Intergenic
1081664534 11:44909134-44909156 CCCCCATGGGACTCTCAGTGAGG - Intronic
1083196203 11:61090128-61090150 TCCTCATGCTTCCCTCAGCCTGG + Intergenic
1084165390 11:67372879-67372901 CCTCCATGGTGCCCACGGCCGGG - Intronic
1084191482 11:67501260-67501282 ACCCCATGGTACCTCCAGCAAGG - Intronic
1084319454 11:68365363-68365385 TCCACATGGGGCCCTCAGCCTGG - Intronic
1084700146 11:70781362-70781384 GCCCCATGGTACCCACTGCCTGG + Intronic
1084939763 11:72606291-72606313 CCTCCAGGATACCCTCAGCTGGG - Intronic
1085202899 11:74712524-74712546 CCCCCCGGGGACCCACAGCCAGG + Intronic
1085350700 11:75796381-75796403 CCCCCATGGTATCATGGGCCTGG + Exonic
1088599243 11:111460891-111460913 CCCCCATGGCATCCCCATCCAGG + Intergenic
1089772838 11:120815709-120815731 CCGCCATGGGACCCTAAGACAGG - Intronic
1090073863 11:123566894-123566916 CCCCCATGGAGTGCTCAGCCTGG + Intronic
1096219691 12:49821261-49821283 CCCCCAACTTCCCCTCAGCCTGG + Intronic
1096964279 12:55612654-55612676 CCCCCATTGCACCCCCAGCAAGG + Intergenic
1102956971 12:117065170-117065192 CCCACATGGTACCGTGAGCCTGG + Intronic
1103240467 12:119409101-119409123 CCCCCATGATACCCACCTCCTGG - Intronic
1103564270 12:121807688-121807710 CCACCCTGGGGCCCTCAGCCTGG + Intronic
1104955993 12:132466091-132466113 TCCTCATCGTCCCCTCAGCCTGG + Intergenic
1107284566 13:38776192-38776214 CCACTATGGTGCCCTCAGACTGG - Intronic
1107629382 13:42327796-42327818 CCCCCAAGATACCATCATCCTGG - Intergenic
1109934542 13:69264508-69264530 TCCACATGGTTCCCTCAGGCAGG + Intergenic
1114083532 14:19220641-19220663 CTCCCGTGGGACCCTCAGCAGGG + Intergenic
1114131711 14:19800309-19800331 CCCACATGCTGCCCTCAGGCTGG + Intronic
1115787501 14:36842772-36842794 CCCACATGGCACTCTCATCCTGG + Intronic
1115979078 14:39029916-39029938 CCCCCATCGTACACCCTGCCAGG - Intergenic
1117913160 14:60653208-60653230 CCCGCCTGCTCCCCTCAGCCAGG - Intronic
1118236356 14:64008711-64008733 CCCTGCTGGAACCCTCAGCCTGG - Intronic
1120187597 14:81410611-81410633 TGCCCATGGTACCCTGAGCAGGG + Intronic
1121228539 14:92339614-92339636 CGCCCACCGTTCCCTCAGCCAGG - Intronic
1123053824 14:105560070-105560092 CCCCCATGGAACCCCCACCCTGG - Intergenic
1123078407 14:105680487-105680509 CCCCCATGGAACCCCCACCCTGG - Intergenic
1127623700 15:60759406-60759428 CCCCCATGTCCCCCTCAACCTGG - Intronic
1128776348 15:70323378-70323400 CCTCCCTGGTTCCTTCAGCCTGG + Intergenic
1128797447 15:70476216-70476238 CCCACATGGCTCCCTCACCCTGG - Intergenic
1129193594 15:73951763-73951785 CCCCCGTGGCCTCCTCAGCCAGG - Intronic
1129712785 15:77829144-77829166 GCCCCATGGGACCCTCAGCCTGG - Intergenic
1132144938 15:99424206-99424228 CCGCCGTGGCACACTCAGCCAGG + Intergenic
1133171947 16:3987156-3987178 CCCCCTTGGAGCCCCCAGCCTGG + Intronic
1134165362 16:11925393-11925415 CCCACACTGTACCCTCTGCCTGG - Intergenic
1134402833 16:13926201-13926223 CCCTCACTGTCCCCTCAGCCTGG + Intronic
1134489941 16:14689049-14689071 CCCACACTGTACCCTCTGCCTGG + Intronic
1134495322 16:14728166-14728188 CCCACACTGTACCCTCTGCCTGG + Intronic
1134500710 16:14767289-14767311 CCCACACTGTACCCTCTGCCTGG + Intronic
1134527247 16:14953894-14953916 CCCACACTGTACCCTCTGCCTGG + Intergenic
1134532705 16:14997023-14997045 ACCACAAGGTCCCCTCAGCCTGG - Intronic
1134545152 16:15102443-15102465 CCCACACTGTACCCTCTGCCTGG - Intronic
1134579872 16:15361760-15361782 CCCACACTGTACCCTCTGCCTGG - Intergenic
1134714836 16:16352438-16352460 CCCACACTGTACCCTCTGCCTGG + Intergenic
1134722713 16:16395800-16395822 CCCACACTGTACCCTCTGCCTGG + Intergenic
1134944715 16:18316071-18316093 CCCACACTGTACCCTCTGCCTGG - Intergenic
1134951979 16:18356221-18356243 CCCACACTGTACCCTCTGCCTGG - Intergenic
1135310321 16:21400289-21400311 CCCACACTGTACCCTCTGCCTGG - Intergenic
1135363269 16:21832706-21832728 CCCACACTGTACCCTCTGCCTGG - Intergenic
1135448521 16:22538354-22538376 CCCACACTGTACCCTCTGCCTGG + Intergenic
1136149906 16:28340623-28340645 CCCACACTGTACCCTCTGCCTGG - Intergenic
1136166140 16:28454427-28454449 CCCACACTGTACCCTCTGCCTGG - Intergenic
1136196831 16:28660593-28660615 CCCACACTGTACCCTCTGCCTGG + Intergenic
1136213171 16:28774716-28774738 CCCACACTGTACCCTCTGCCTGG + Intergenic
1136257902 16:29054633-29054655 CCCACACTGTACCCTCTGCCTGG + Intergenic
1136265993 16:29118792-29118814 CCCCCATGCTTCCCTCTGCTGGG + Intergenic
1136307067 16:29379433-29379455 CCCACACTGTACCCTCTGCCTGG - Intergenic
1136320591 16:29481676-29481698 CCCACACTGTACCCTCTGCCTGG - Intergenic
1136435164 16:30221016-30221038 CCCACACTGTACCCTCTGCCTGG - Intergenic
1136545688 16:30953510-30953532 CCCCCATGGTGCCCACATCCCGG + Exonic
1137476128 16:48811276-48811298 CTCCCAAGGCAGCCTCAGCCGGG + Intergenic
1137912523 16:52392444-52392466 GACACAGGGTACCCTCAGCCAGG + Intergenic
1137913425 16:52402940-52402962 GCCCCATGGGACCCTCAGGGTGG + Intergenic
1138127692 16:54452391-54452413 CCCACATGGTGCCCAAAGCCTGG - Intergenic
1138503248 16:57462079-57462101 CCCACATGGTGCCCACTGCCAGG + Intergenic
1138652134 16:58466615-58466637 CCCCCATTGTACCTGCAACCTGG + Intronic
1139369534 16:66458271-66458293 CCTCCATGCTACACTCAGCAAGG + Intronic
1139855195 16:69974414-69974436 CCCACACTGTACCCTCTGCCTGG - Intergenic
1139863329 16:70043710-70043732 ACCACAAGGTCCCCTCAGCCTGG + Intergenic
1139884913 16:70201547-70201569 CCCACACTGTACCCTCTGCCTGG - Intergenic
1139990772 16:70938079-70938101 CTGCCATGGGATCCTCAGCCTGG - Intronic
1140367604 16:74393978-74394000 CCCACACTGTACCCTCTGCCTGG + Intergenic
1140780502 16:78292217-78292239 CCCTCATGGCACCATCAGTCTGG - Intronic
1141658632 16:85429708-85429730 CCCCCACTGTTCCCTCTGCCTGG + Intergenic
1142054803 16:87986700-87986722 CCCCCATGCTTCCCTCTGCTGGG + Intronic
1142103103 16:88285974-88285996 CCCCCATCGGACCCACAGCCCGG + Intergenic
1142222981 16:88864476-88864498 CCCGAATGGTATCCTGAGCCGGG - Intronic
1145933983 17:28704440-28704462 CACACATGGGACTCTCAGCCTGG + Intronic
1146183985 17:30713059-30713081 CCCCCATGGCACCCCCCGCATGG - Intergenic
1147583434 17:41639195-41639217 CCCTCAGGTTGCCCTCAGCCAGG - Intergenic
1148454707 17:47804849-47804871 ACCCCAGGCTCCCCTCAGCCTGG + Intergenic
1150736975 17:67749362-67749384 ACGCCACGGTACCCTTAGCCTGG - Intergenic
1152630209 17:81407561-81407583 CCACCATGGCACCCCCATCCTGG - Intronic
1154116620 18:11617398-11617420 CCCACACTGTACCCTCTGCCTGG - Intergenic
1155177299 18:23312193-23312215 CCCCCACCATACCCACAGCCTGG + Intronic
1157932940 18:51842916-51842938 CCCTGATGGTGCCCACAGCCTGG + Intergenic
1158278221 18:55791971-55791993 CCCCCATGCTGCTCTCAGCCTGG + Intergenic
1158852055 18:61504354-61504376 CTGCCATGGTTCCCTTAGCCAGG - Intronic
1159379987 18:67644183-67644205 CCCCCATGGCTCACTCAGACTGG - Intergenic
1160160099 18:76464569-76464591 CCTCCCTGGCACCCCCAGCCTGG + Intronic
1160160134 18:76464695-76464717 CCTCCCTGGCACCCCCAGCCTGG + Intronic
1160831543 19:1106862-1106884 CCTCCATGGCACCCCCAGCCTGG - Intergenic
1160860121 19:1234150-1234172 CCCCCATGGTGTCCACAGCCGGG - Intronic
1161071131 19:2261738-2261760 CCCCCAGGGGACCCTCAGCATGG + Intronic
1162141810 19:8589739-8589761 CCCCCATGGTACCGTATCCCAGG + Intronic
1165648875 19:37468799-37468821 CCCACCCGCTACCCTCAGCCTGG - Intronic
1166944147 19:46386934-46386956 CCCCCTTGGTACCTCCAGTCTGG + Intronic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1167559134 19:50215003-50215025 CCCCCCCGCTCCCCTCAGCCTGG - Intronic
926045727 2:9708288-9708310 CCCACAGGGGAGCCTCAGCCTGG - Intergenic
927131842 2:20066648-20066670 CCATCATGGTAACCACAGCCTGG + Intergenic
928204988 2:29277648-29277670 TCTCCATGCTACCCTCAGTCAGG + Intronic
931263230 2:60638294-60638316 CTCCCCTGGCCCCCTCAGCCTGG - Intergenic
931855488 2:66298396-66298418 CCGCCATGTGACCCTGAGCCAGG - Intergenic
932486082 2:72085189-72085211 CCCCCATGGTGGCCTCTCCCAGG + Intergenic
932892500 2:75609151-75609173 CCTCAGTGGTAACCTCAGCCAGG - Intergenic
933172196 2:79136858-79136880 CCACAAAGGCACCCTCAGCCTGG + Intergenic
936078621 2:109417531-109417553 CCTCCACAGGACCCTCAGCCAGG + Intronic
936499082 2:113051527-113051549 GCCCCGTGGCACCCTCTGCCTGG - Intronic
937992602 2:127672880-127672902 CCCCCATGCTGCCCAGAGCCAGG - Intronic
939966901 2:148619192-148619214 CCTCCATGGCCCCCTCAGCAAGG + Intergenic
945214557 2:207419765-207419787 CTTCCATGGTGCCCTCAGCATGG + Intergenic
948254071 2:236553203-236553225 CACCCATGGGGCCCTCAGCAGGG - Intergenic
948988140 2:241538576-241538598 CCCCCATCAGACCCACAGCCAGG - Intergenic
1171438929 20:25146292-25146314 CCCCCATGATCCCCTTAGCAAGG + Intergenic
1172212930 20:33213669-33213691 CCCTCATGGTTCCCTCTGCCTGG + Intergenic
1175260320 20:57670117-57670139 CCACCTTGGGGCCCTCAGCCAGG - Intronic
1175498052 20:59428821-59428843 CCCCTGTTGTACCCTCTGCCTGG - Intergenic
1176248466 20:64108902-64108924 CCCACAGTGTACCCTCAGGCTGG - Intergenic
1176710364 21:10145474-10145496 CCCCTGTGGGACCCTCAGCAGGG - Intergenic
1178718933 21:34991325-34991347 CTGCCATGGCTCCCTCAGCCTGG + Intronic
1179505625 21:41838140-41838162 GCCCCATGGGAACCACAGCCAGG + Intronic
1180178981 21:46109548-46109570 GCCCCTTGGTACCAGCAGCCTGG - Intronic
1180294443 22:10872626-10872648 CTCCCGTGGGACCCTCAGCAGGG - Intergenic
1180497249 22:15902040-15902062 CTCCCGTGGGACCCTCAGCAGGG - Intergenic
1181386285 22:22548225-22548247 CATCCATGGTACCCTCCACCTGG - Exonic
1181579120 22:23817230-23817252 CCCCCCTGGAGCACTCAGCCTGG - Intronic
1182463654 22:30500802-30500824 CTGCCCTGGTCCCCTCAGCCTGG - Intronic
1183272259 22:36869551-36869573 CCCCCATGGGATCCTCTGCAGGG + Intronic
1183469842 22:37999394-37999416 CCCCTGTGGCAGCCTCAGCCTGG + Intronic
1184459662 22:44629921-44629943 CCCCCATGGTAGCATCATCCAGG - Intergenic
1184869468 22:47226081-47226103 GCCCCTTGGCACCCACAGCCTGG - Intergenic
1185281609 22:49972204-49972226 CCCCGACGGTGCCCCCAGCCTGG - Intergenic
949097685 3:105618-105640 CCTCCATGGCTCCCTCAACCAGG - Intergenic
951265516 3:20561251-20561273 CCCCTATGGTACTTTCAGTCTGG - Intergenic
952304386 3:32132764-32132786 CCCCCATGGTTCCCAAAGCATGG - Intronic
959505547 3:107152601-107152623 CCCCAAAGCTTCCCTCAGCCAGG - Intergenic
961364393 3:126390063-126390085 CCCCCTCGGTGCCCTCTGCCTGG - Intergenic
962890953 3:139672602-139672624 CCCCCATGCTACTCTTAGTCGGG - Intronic
963168012 3:142225072-142225094 GGCCCCTGGCACCCTCAGCCTGG + Intronic
963173047 3:142270773-142270795 GCCCCAAGGTACCCACAGCCAGG + Intergenic
963483324 3:145904195-145904217 CCCCCATGGCACCCATAGCCTGG + Intergenic
967231159 3:187338590-187338612 CTGCCATCCTACCCTCAGCCTGG - Intergenic
967284385 3:187854121-187854143 CCCTCATGGAGCCCACAGCCTGG + Intergenic
967328148 3:188263111-188263133 CCTCCATGGAATCCTCGGCCCGG + Intronic
970428611 4:15967352-15967374 ACCCCATTGCACACTCAGCCTGG - Intronic
977705699 4:100067849-100067871 CACCCATTGTTCCTTCAGCCTGG - Intergenic
978826837 4:113034727-113034749 CCATCATGGTAGCCTAAGCCAGG - Intronic
980889948 4:138804227-138804249 CTACCCTGGTACCCTGAGCCAGG + Intergenic
984091040 4:175375881-175375903 CCCCCATGTAACCCCCAGACAGG - Intergenic
986503907 5:8429857-8429879 GCCCCATGGTGCCAGCAGCCTGG - Intergenic
997511669 5:134458811-134458833 CACCCTTGGAACCATCAGCCTGG - Intergenic
998176484 5:139904771-139904793 CCCCCATGCTGTCCTTAGCCTGG - Intronic
999390204 5:151184100-151184122 CCCACAGAGTACACTCAGCCAGG + Intronic
1002282247 5:178138104-178138126 GCTCCATGGTGGCCTCAGCCTGG - Exonic
1006389895 6:33752030-33752052 TCCCCATGTGACCCTCAGCAGGG - Intergenic
1007167765 6:39841011-39841033 CCCCCATGGAACCCTCCCCGTGG - Intronic
1007167840 6:39841188-39841210 TCCCCATGGAACCCTCCCCCTGG - Intronic
1007167916 6:39841368-39841390 CCCCCCTGGAACCCTCCCCCTGG - Intronic
1007810636 6:44483208-44483230 CCCACATGGAACACTGAGCCTGG - Intergenic
1011284081 6:85705588-85705610 CCACCATGTTCCCCTCATCCAGG - Intergenic
1011742250 6:90373783-90373805 CCTCCATTGTGGCCTCAGCCTGG + Intergenic
1014738731 6:125124218-125124240 ACCCCATTGTGCCCTCTGCCTGG + Intronic
1017722364 6:157252856-157252878 CCCCCAAGGTACACTGTGCCTGG + Intergenic
1018726648 6:166617969-166617991 CCCCAATGGTGTCATCAGCCTGG - Intronic
1019148523 6:169988913-169988935 CTCCCACGGCCCCCTCAGCCGGG + Intergenic
1024249968 7:47498747-47498769 CCAACATGGTCCCGTCAGCCCGG + Intronic
1024872636 7:53983779-53983801 CTCCCATGGCAGGCTCAGCCTGG - Intergenic
1026901388 7:74039402-74039424 CCCCCATGGCACCCCCAGGGAGG + Intronic
1028170107 7:87586061-87586083 CCTCCATGGTATCCTCAGAGGGG - Intronic
1029467855 7:100737215-100737237 ACCCCATGAGCCCCTCAGCCAGG - Intronic
1032446190 7:131985739-131985761 CCCCCCTGGGACCCTCTTCCTGG + Intergenic
1034244677 7:149635504-149635526 CCACCAGGGTGTCCTCAGCCAGG + Intergenic
1034274661 7:149818743-149818765 CCCCCATGGTGCAGTTAGCCAGG - Intergenic
1034831886 7:154315778-154315800 ACCACATGGTGGCCTCAGCCTGG + Intronic
1035077361 7:156189706-156189728 CTCGCATGGCGCCCTCAGCCTGG + Intergenic
1035203688 7:157281484-157281506 ACCCCTTGGTGCCCACAGCCTGG - Intergenic
1035779611 8:2217220-2217242 TCCCCTTGGTACCCTCTGCAGGG + Intergenic
1037210209 8:16376908-16376930 CCGCCAGGGTCCCCTCAGGCTGG + Intronic
1037783731 8:21889371-21889393 CCCCGGTGGTACCCTAATCCAGG + Intergenic
1039555119 8:38469564-38469586 CCCCAATGGTGGCCTCAGCCTGG - Intergenic
1040725676 8:50379050-50379072 GCCCCTTGGTACCTACAGCCTGG - Intronic
1044008508 8:86964753-86964775 CCCCAGTGGTACCTTCAGCAGGG - Intronic
1048977218 8:139679882-139679904 AGCCCATGCTTCCCTCAGCCTGG + Intronic
1049300463 8:141866902-141866924 CCCCCATGATCCCCACAGCCGGG - Intergenic
1049473185 8:142785268-142785290 CGCCCACAGTGCCCTCAGCCTGG - Exonic
1049484379 8:142845899-142845921 CCTTCCTGGGACCCTCAGCCTGG - Intronic
1050052401 9:1616804-1616826 ACACCATAGTACCCTGAGCCAGG - Intergenic
1052345089 9:27401261-27401283 CCCAGCTGGCACCCTCAGCCTGG + Intronic
1053199326 9:36142070-36142092 CCCCCTGGGGTCCCTCAGCCAGG + Intronic
1053489364 9:38487730-38487752 CCCCCTTGGTGCCCGCAGCGAGG - Intergenic
1054328335 9:63729128-63729150 CCCCTGTGGGACCCTCAGCAGGG - Intergenic
1057112750 9:92489671-92489693 CCCACTTGGCTCCCTCAGCCTGG + Intronic
1057669711 9:97077050-97077072 CCCCCTTGGTGCCCGCAGCGAGG - Intergenic
1061506056 9:131032402-131032424 TTCCCATTGTCCCCTCAGCCTGG + Intronic
1061980449 9:134100270-134100292 CCCCCTTGGTAGCCTCAGCAGGG - Intergenic
1062018982 9:134307370-134307392 TCCCCATGCTACCCACAGCTGGG + Intergenic
1062036950 9:134386607-134386629 CTCCCATGACACCCTCAGCACGG - Intronic
1062099588 9:134721262-134721284 CCCCCATGGGACCCCCATCCAGG + Intronic
1062124641 9:134853423-134853445 TCCCCATCATGCCCTCAGCCTGG + Intergenic
1062314112 9:135957216-135957238 CCCCCAACATCCCCTCAGCCTGG - Intronic
1062459557 9:136657208-136657230 GCCCCATGGGAACCTCAGCAGGG + Intergenic
1202795128 9_KI270719v1_random:114469-114491 CCCCTGTGGGACCCTCAGCAGGG - Intergenic
1186080068 X:5921580-5921602 CCCCTATGGTACCAACAGCCTGG + Intronic
1190041159 X:47073462-47073484 CCGCCATGGCACCCACAGCTAGG + Intergenic
1191880127 X:65837397-65837419 GTTCCATGGTACCCTAAGCCAGG + Intergenic
1192594295 X:72389905-72389927 CCCCCATGGTACCCTCAGCCTGG - Intronic
1198094254 X:133362932-133362954 GCCCCATTCTACCGTCAGCCTGG - Intronic
1198150525 X:133903952-133903974 CCCCATTGCTACCCTGAGCCAGG - Intronic
1199251020 X:145661575-145661597 ACCTCATGGGAGCCTCAGCCTGG + Intergenic