ID: 1192594488

View in Genome Browser
Species Human (GRCh38)
Location X:72392268-72392290
Sequence GCCACCTGGTAAGCTGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192594488_1192594496 15 Left 1192594488 X:72392268-72392290 CCCCTGCCAGCTTACCAGGTGGC 0: 1
1: 0
2: 0
3: 21
4: 208
Right 1192594496 X:72392306-72392328 TTAGTCACTTCTTGGGGTTAAGG 0: 1
1: 0
2: 1
3: 14
4: 819
1192594488_1192594495 9 Left 1192594488 X:72392268-72392290 CCCCTGCCAGCTTACCAGGTGGC 0: 1
1: 0
2: 0
3: 21
4: 208
Right 1192594495 X:72392300-72392322 TCACTATTAGTCACTTCTTGGGG 0: 1
1: 0
2: 1
3: 6
4: 93
1192594488_1192594493 7 Left 1192594488 X:72392268-72392290 CCCCTGCCAGCTTACCAGGTGGC 0: 1
1: 0
2: 0
3: 21
4: 208
Right 1192594493 X:72392298-72392320 TCTCACTATTAGTCACTTCTTGG 0: 1
1: 0
2: 1
3: 18
4: 185
1192594488_1192594494 8 Left 1192594488 X:72392268-72392290 CCCCTGCCAGCTTACCAGGTGGC 0: 1
1: 0
2: 0
3: 21
4: 208
Right 1192594494 X:72392299-72392321 CTCACTATTAGTCACTTCTTGGG 0: 1
1: 0
2: 2
3: 13
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192594488 Original CRISPR GCCACCTGGTAAGCTGGCAG GGG (reversed) Intronic
900011458 1:113916-113938 GCCAACTGGCATGCTGTCAGTGG + Intergenic
900027559 1:290482-290504 GCCAACTGGCATGCTGTCAGTGG + Intergenic
900041517 1:469924-469946 GCCAACTGGCATGCTGTCAGTGG + Intergenic
900062951 1:704901-704923 GCCAACTGGCATGCTGTCAGTGG + Intergenic
900360910 1:2288665-2288687 GCCACAGAGTCAGCTGGCAGTGG + Intronic
900780891 1:4616539-4616561 GACACCTGGTAGACTGGAAGGGG + Intergenic
901059287 1:6464707-6464729 GCCACCTGGGAGGCTGGTGGGGG + Exonic
901337931 1:8467509-8467531 GGCACACAGTAAGCTGGCAGTGG + Intronic
902671835 1:17980015-17980037 GCCACCTGCACAGCTGCCAGGGG + Intergenic
903265129 1:22153619-22153641 GCCACGTGCAAAGCTGGAAGAGG + Intergenic
906120341 1:43385963-43385985 TCAACCAGGTAAGGTGGCAGGGG - Exonic
906306707 1:44724385-44724407 GCCATCGGGTAAGCGGGCAGGGG + Exonic
906791039 1:48659040-48659062 GTCACCTGGTAAGTTGGTGGTGG - Intronic
908095507 1:60733117-60733139 GCCACCAGGTAAGCTGCAAGAGG + Intergenic
912924316 1:113900460-113900482 ACCACCTGGTCATATGGCAGTGG - Intronic
915322128 1:155061940-155061962 ACCACCGGGTCAGCGGGCAGAGG - Exonic
916684385 1:167131515-167131537 GCCACCTGACAACCTGGCAGAGG + Intergenic
917303502 1:173603640-173603662 GCCACCTTTTAAGCAGTCAGTGG - Intergenic
917800520 1:178565456-178565478 GCTACCTGGGAAGCTGACATGGG + Intergenic
921839697 1:219815445-219815467 GCCACCAGTTAGTCTGGCAGGGG - Intronic
921886587 1:220313484-220313506 GCTACCTGGGAGGCTGACAGGGG + Intergenic
922259898 1:223929926-223929948 GCCAACTGGCATGCTGTCAGTGG + Intergenic
924341060 1:243032485-243032507 GCCAACTGGCATGCTGTCAGTGG + Intergenic
924740181 1:246790262-246790284 GGCTGCTGGGAAGCTGGCAGGGG + Intergenic
1063390361 10:5646228-5646250 GCCACCTGGTAATGTGGTGGGGG + Intronic
1063666034 10:8061295-8061317 CCCAACTGGAAAGGTGGCAGTGG - Intronic
1064401856 10:15028114-15028136 GCCACCTTTTAAGCAGTCAGTGG - Intergenic
1066735408 10:38472927-38472949 GCCAACTGGCATGCTGTCAGTGG - Intergenic
1067004125 10:42645432-42645454 GCCACCTTTTAAGCAGTCAGTGG - Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1069618755 10:69823451-69823473 GCCACACGCTGAGCTGGCAGAGG - Intronic
1072000424 10:91190134-91190156 GCCACCTGGAAACCAGGAAGTGG - Intronic
1076024321 10:127099981-127100003 CCCACCTGGGAAACTGGAAGAGG + Intronic
1076328468 10:129646618-129646640 GCCACGTGTTAAGCTGCCACGGG - Intronic
1076735650 10:132457808-132457830 GCCACCTGGTGATCTGGCACAGG - Intergenic
1076967791 11:106152-106174 GCCAACTGGCATGCTGTCAGTGG + Intergenic
1077186003 11:1235664-1235686 GCCGCCTGTGAAGCTGGGAGAGG - Intronic
1077340927 11:2025989-2026011 GCCACCTGGTCAGGAGGGAGAGG - Intergenic
1077352595 11:2099823-2099845 GCCAGCAGGTGAGCAGGCAGAGG - Intergenic
1077465466 11:2731747-2731769 GCCTCCTGGGTGGCTGGCAGAGG - Intronic
1078652295 11:13207147-13207169 GCCACGTGGTCAGCTGGAAGTGG + Intergenic
1079469055 11:20760855-20760877 GAGACCTGGGAATCTGGCAGTGG - Intronic
1082623114 11:55448641-55448663 GCAACGAAGTAAGCTGGCAGAGG + Intergenic
1082800096 11:57408173-57408195 GTCACATGGGAAGCTGGTAGAGG + Intronic
1084955353 11:72688440-72688462 CCCACCTGGTAAGCTGGGACTGG - Exonic
1084966420 11:72746969-72746991 GCCAGTAGGAAAGCTGGCAGGGG + Intronic
1089149823 11:116356129-116356151 GCGACCTGGCAGGCTGGGAGAGG - Intergenic
1089641139 11:119847987-119848009 CCCACCTGGGAAGCTGCCTGTGG + Intergenic
1202823912 11_KI270721v1_random:81178-81200 GCCACCTGGTCAGGAGGGAGAGG - Intergenic
1092029645 12:5273725-5273747 GCCCCCTGGGAGGGTGGCAGGGG + Intergenic
1092713557 12:11364419-11364441 GCCACATGGTAAGTTGACATTGG - Intronic
1092717266 12:11403634-11403656 GCCACATGGTAAGTTGACATTGG - Intronic
1095374096 12:41505567-41505589 GGCCCTTGGTAAGCTGGCATAGG + Intronic
1097199808 12:57268917-57268939 CCCACTTGGTAAGAAGGCAGTGG + Exonic
1103340186 12:120216858-120216880 GCCACGTGGGAAGCGGGCCGGGG - Intronic
1105840711 13:24251733-24251755 GGCACCTGGTGAGCAGGCATGGG - Exonic
1106019160 13:25898674-25898696 GCCAGCTGGGAAGCTGGAACTGG - Intronic
1106419795 13:29576826-29576848 GGCACCTGGCAAGTGGGCAGAGG + Intronic
1106941732 13:34787511-34787533 GCTACCTGGGAAGCTGACACAGG + Intergenic
1107490281 13:40874892-40874914 GCCACCTTTTAAGCAGTCAGTGG - Intergenic
1107592736 13:41925585-41925607 GCCTTCTGGAAAGGTGGCAGTGG + Intronic
1110268307 13:73564850-73564872 TCCACCGGGTAATCTGGCACTGG - Intergenic
1113391443 13:109901086-109901108 GCCACCTCCTAAACTGTCAGAGG + Intergenic
1114696496 14:24631671-24631693 GCCTCCTGGTAAGTTTGCAGAGG + Intronic
1119473084 14:74911345-74911367 GCCACATGGTGAGCAGGGAGCGG - Exonic
1121229031 14:92342781-92342803 TCCACCTGCTATGCAGGCAGAGG + Intronic
1121525031 14:94613728-94613750 ACCACGTGGCAACCTGGCAGGGG + Exonic
1121717222 14:96084881-96084903 GCCACCTGGTGACCTGGTAATGG + Intronic
1122156614 14:99753940-99753962 GCCACCTGGCAGCCTAGCAGTGG - Intronic
1122344504 14:101050162-101050184 CCCACCAGGTCGGCTGGCAGAGG - Intergenic
1122518545 14:102326237-102326259 ACCACCTGGAGGGCTGGCAGTGG - Exonic
1122988111 14:105221929-105221951 TCCACCTGTTAACCAGGCAGAGG + Intronic
1124628855 15:31326205-31326227 GCCACCCGGCAAGCCGGCGGCGG + Intergenic
1126352550 15:47759617-47759639 CCCACCAGGAATGCTGGCAGTGG - Intronic
1128599579 15:68984507-68984529 GCCACCTTTTAAGCAGTCAGTGG - Intronic
1128706784 15:69842564-69842586 GCTCCCTGGGAAGCTGGCACAGG - Intergenic
1129154843 15:73711301-73711323 TCCCCCTGGTGAGATGGCAGAGG + Intronic
1129390047 15:75215852-75215874 GGCACCCGCTGAGCTGGCAGAGG - Intergenic
1130212409 15:81936768-81936790 GCCACCTGGTAGGGTCTCAGAGG - Intergenic
1131108672 15:89750980-89751002 GCCGCCTGGGCAGCGGGCAGAGG - Exonic
1131549514 15:93344960-93344982 GCCACCTTTTAAGCAGTCAGTGG - Intergenic
1132672785 16:1108550-1108572 GCCACCTGTTGAGCCGGCAAGGG - Intergenic
1137628317 16:49923463-49923485 GTCACCTGGAAAGCAGGCATGGG - Intergenic
1138241500 16:55431035-55431057 GACACCTGGTAAGGAGGCAGAGG - Intronic
1138537280 16:57666775-57666797 CCCACCTGGGAAGTGGGCAGAGG - Intergenic
1138847196 16:60580613-60580635 GCCACATGGTAAAATGTCAGAGG - Intergenic
1141754004 16:85979214-85979236 CTCACCCGGTGAGCTGGCAGCGG + Intergenic
1141806533 16:86345560-86345582 GCCATGTGGTGAGCTGGGAGAGG - Intergenic
1141807561 16:86351951-86351973 GCCATGTGGTGAGCTGGGAGAGG + Intergenic
1142034435 16:87854810-87854832 CCCACCTGGCTGGCTGGCAGGGG + Intronic
1142195894 16:88739180-88739202 GCCACCCAGAAGGCTGGCAGGGG - Intronic
1142286334 16:89173027-89173049 GGCGCCTGGTCAGCTGCCAGGGG - Intronic
1142452889 16:90192987-90193009 GCCAACTGGCATGCTGTCAGTGG - Intergenic
1142893324 17:2959106-2959128 GCACTCTGGGAAGCTGGCAGGGG + Intronic
1147156395 17:38546448-38546470 GCCACCTGCTTACCTGGAAGTGG + Intronic
1148158167 17:45435205-45435227 GCCACCTTGTAATCTGAAAGGGG + Intergenic
1148351356 17:46944061-46944083 GGCTCCTGGAGAGCTGGCAGAGG + Intronic
1150361648 17:64540216-64540238 GCCACTTGGGAGGCTGGCATAGG + Intronic
1150642708 17:66960414-66960436 GCCACCTCCTCAGCTGGCAAGGG + Intergenic
1151624229 17:75266673-75266695 CCCACCTCTAAAGCTGGCAGTGG - Exonic
1152377165 17:79924805-79924827 GCCACCTGGAAAGATGACACTGG + Intergenic
1203167723 17_GL000205v2_random:113515-113537 CCCACCTGGTTAGCTGGCAAAGG + Intergenic
1153300339 18:3586572-3586594 GCCACCTATTCAGCAGGCAGAGG - Intronic
1157689187 18:49667123-49667145 GCCACCTGGACTGGTGGCAGTGG + Intergenic
1157805844 18:50657037-50657059 GCCACGTGGGGAGGTGGCAGAGG - Intronic
1158931203 18:62325936-62325958 GCCTCCAGGCGAGCTGGCAGGGG - Intronic
1161841551 19:6684646-6684668 ACCACCTGGTAAGATGGGAGAGG + Exonic
1162566579 19:11448212-11448234 GCCTCCTGGGCAGCTGGGAGAGG - Exonic
1162721946 19:12667880-12667902 GCCATCTGGTGAGTTGCCAGAGG + Intronic
1162760061 19:12883596-12883618 GCTACCTGGTAGGCTGACACAGG + Intergenic
1162788645 19:13051825-13051847 GGCACCTGCTAAGGCGGCAGCGG - Intronic
1164157351 19:22604689-22604711 GGCACCTGGAAAGCTGACATGGG + Intergenic
1164598972 19:29548571-29548593 GCCTCCTTGCAAGGTGGCAGAGG + Intronic
1165845120 19:38813076-38813098 GTCACCAGGGAAGCTGGCAAGGG - Exonic
1168594779 19:57666420-57666442 GCTGCCTCGGAAGCTGGCAGGGG + Intergenic
925181513 2:1820040-1820062 GCCAGCGAGGAAGCTGGCAGAGG + Intronic
925995742 2:9291702-9291724 GCCACTTGGGAATCAGGCAGAGG - Intronic
926265943 2:11320774-11320796 GTCACCTGGTCACCTGGAAGTGG - Intronic
929379546 2:41334306-41334328 GCATCCTGGAAAGCTCGCAGGGG + Intergenic
929860173 2:45670115-45670137 GCCACCTCTTCAGCTAGCAGAGG - Intronic
929918744 2:46157324-46157346 CTCAGCTGGTATGCTGGCAGGGG - Intronic
930387641 2:50717753-50717775 GCCACCTGTGAACCTGGAAGTGG - Intronic
930993178 2:57685155-57685177 GCCACCTGGAGATCAGGCAGAGG + Intergenic
933966703 2:87435829-87435851 CCCACCTGCTTTGCTGGCAGGGG + Intergenic
936235999 2:110743355-110743377 GCCACATGGGAAAGTGGCAGTGG + Intronic
936526531 2:113245367-113245389 GCCACCTAGAAAGCTAGCCGAGG + Intronic
937127765 2:119485151-119485173 GCCACCTGGGAAAATTGCAGGGG + Intronic
937914972 2:127094505-127094527 GCCTCCTGGCTAGCAGGCAGCGG - Intronic
938343802 2:130552373-130552395 GCCTCCTGCTGAGATGGCAGCGG + Intergenic
938346031 2:130568349-130568371 GCCTCCTGCTGAGATGGCAGCGG - Intergenic
944632736 2:201643344-201643366 GCCACCTGGTGAGCGGCGAGGGG - Exonic
946084688 2:217158637-217158659 GCTACCTGAGCAGCTGGCAGGGG + Intergenic
946608431 2:221431779-221431801 GCCATCTTCCAAGCTGGCAGTGG - Intronic
947480882 2:230498993-230499015 GCCACATGGGAAGCTGGTATGGG - Intronic
948066459 2:235084429-235084451 ACCACATGGGAAGCTGGCAGAGG - Intergenic
948945392 2:241216670-241216692 ACCACCTGGTAAGGTGACAGTGG - Intronic
949062964 2:241971838-241971860 GCCTCCTGGGAAGTTGGGAGGGG + Intergenic
949084329 2:242137650-242137672 GCCAACTGGCATGCTGTCAGTGG - Intergenic
1169658312 20:7950979-7951001 GCCACTTGGGAGGCTGGCACAGG + Intergenic
1170121725 20:12919524-12919546 GCCACATGGGATGCTGGCAGTGG - Intergenic
1171046208 20:21810847-21810869 GCCACTTGGGAAGGTGGCAGTGG - Intergenic
1173556493 20:43969780-43969802 GGCACTTGAGAAGCTGGCAGAGG - Intronic
1175158641 20:56991573-56991595 TCCAGCTGGAAAGCTGGCCGAGG + Intergenic
1175444157 20:59008620-59008642 GCCACCTGATGACCTGGCAAGGG - Intergenic
1175991649 20:62792858-62792880 GCCAGCTGATAGCCTGGCAGGGG + Intergenic
1176280912 20:64310133-64310155 GCCAACTGGCATGCTGTCAGTGG - Intergenic
1176404034 21:6345621-6345643 CCCACCTGGTTAGCTGGCAAAGG - Intergenic
1176433123 21:6643483-6643505 CCCACCTGGTTAGCTGGCAAAGG + Intergenic
1176874551 21:14115385-14115407 GCCACCTTTTAAGCTGTCAGTGG - Intronic
1177776395 21:25571831-25571853 ACCAGCTGGTAAAGTGGCAGGGG - Intergenic
1179943383 21:44654267-44654289 GCCACCTGCTCAGCAGCCAGTGG + Exonic
1182034707 22:27188773-27188795 GCCCCCAGGTGAGCTGGCACAGG - Intergenic
1182855113 22:33510226-33510248 GCCACCTTGTAAGGGGGTAGTGG + Intronic
1184653906 22:45931780-45931802 GGCTCCTGGGAGGCTGGCAGAGG - Intronic
961741680 3:129036918-129036940 GCCACCTGGAAGGCTGGGAGAGG + Intronic
967770691 3:193330615-193330637 GGGACCTGGAAAGGTGGCAGAGG - Intronic
969037023 4:4262665-4262687 TTCACATGGTAGGCTGGCAGTGG - Intergenic
970442398 4:16093110-16093132 GACACCAGGTAGGGTGGCAGGGG + Intergenic
974809607 4:66929077-66929099 ACCACCTAGAAAGCTTGCAGTGG - Intergenic
978974815 4:114856834-114856856 GCCACCTTTTAAGCTTTCAGGGG + Intronic
980932377 4:139194296-139194318 GCCACATGGATAGCTGGCACTGG + Intergenic
986418734 5:7554924-7554946 GACACCTGGGAAGCTGAGAGAGG - Intronic
989800603 5:45533919-45533941 GCCATCTGCTAAGTGGGCAGTGG + Intronic
991631263 5:68658458-68658480 GCCACATGGGAAGTTGGCTGGGG - Intergenic
992415070 5:76544502-76544524 GCCACCTTGTGAGCTGCCTGTGG + Intronic
992472050 5:77067506-77067528 GAGACCAGGAAAGCTGGCAGTGG - Intergenic
993968144 5:94383163-94383185 GCCAGGTGGTAAGCTTGCTGGGG + Intronic
995528173 5:113067317-113067339 GACACCTGGAGACCTGGCAGGGG + Intronic
996083871 5:119284249-119284271 GCCACCTAGCCAGCTTGCAGGGG + Intronic
998637489 5:143972093-143972115 GCCACGAGGTAAGCTGGGAAAGG - Intergenic
998957339 5:147452072-147452094 ACCAGCTGGGAAGCTGGTAGGGG + Intronic
999116261 5:149166367-149166389 TCCATGTGGGAAGCTGGCAGAGG - Intronic
1001561261 5:172670349-172670371 GCCCCCTGGGGACCTGGCAGCGG + Intronic
1001843801 5:174903387-174903409 GCAATCTGGAAAGTTGGCAGTGG - Intergenic
1002076280 5:176710422-176710444 GACACCGGGGCAGCTGGCAGGGG - Intergenic
1002732329 5:181349004-181349026 GCCAACTGGCATGCTGTCAGTGG - Intergenic
1002752210 6:125100-125122 GCCAACTGGCATGCTGTCAGTGG + Intergenic
1004396398 6:15249021-15249043 GCCACTTGGGAAGCGGGGAGCGG + Intronic
1005391677 6:25340242-25340264 GCCACGTGGTAAGGAAGCAGAGG + Intronic
1006140078 6:31923236-31923258 GCCTCCTGGAGAGCTGACAGTGG + Intronic
1007166230 6:39830814-39830836 TCCACCTGGATAGCTGCCAGTGG + Intronic
1007664301 6:43505407-43505429 ACCTGCTGGTCAGCTGGCAGCGG + Exonic
1013175908 6:107676268-107676290 TCCAACTGGAAAGCTGGCAGTGG + Intergenic
1013211548 6:107991429-107991451 GCCACCTTTTAAGCAGTCAGTGG - Intergenic
1015622202 6:135142812-135142834 ACCACCCAGTAAACTGGCAGAGG + Intergenic
1017525832 6:155240755-155240777 GGCAAGTGGTATGCTGGCAGAGG + Intronic
1018634912 6:165852610-165852632 TCCACATGGTGGGCTGGCAGTGG - Intronic
1018699500 6:166415630-166415652 GCCATCTTGGAAGCTGGCATGGG - Intronic
1018737007 6:166694561-166694583 ACCACCTGGTAACTGGGCAGGGG + Intronic
1019236580 6:170621320-170621342 GCCAACTGGCATGCTGTCAGTGG - Intergenic
1022805742 7:33820497-33820519 GCCACCAGAGAAGCTGGAAGTGG - Intergenic
1023287532 7:38634362-38634384 GCCACCTGGCAACCTGAAAGTGG - Intergenic
1027517020 7:79155116-79155138 GCCAGCTGGTTTGCAGGCAGGGG + Intronic
1029226230 7:99030496-99030518 ACCTCCTGCAAAGCTGGCAGAGG - Exonic
1032429894 7:131852206-131852228 TCCACCTGGAAAGATTGCAGTGG + Intergenic
1035253715 7:157613272-157613294 GTCACCTGCTGAGCTGACAGCGG - Intronic
1035511191 8:185288-185310 GCCAACTGGCATGCTGTCAGTGG + Intergenic
1035819730 8:2578624-2578646 AACAACTGGGAAGCTGGCAGTGG + Intergenic
1037822264 8:22140738-22140760 GCCACTTGGCAAGGTGGGAGTGG - Intronic
1038423621 8:27450941-27450963 GCCACCTGGGGAGGTGGAAGAGG - Intronic
1039509798 8:38081938-38081960 GCCACCTTTTAAGCAGTCAGTGG + Intergenic
1039510994 8:38091690-38091712 GCCACCTTTTAAGCAGTCAGTGG + Intergenic
1040037729 8:42886774-42886796 GCAACCTGGGAAGCTGGGATGGG + Intronic
1040356292 8:46621677-46621699 CCTACCTGGAATGCTGGCAGAGG - Intergenic
1041451131 8:58007686-58007708 GCCACCTGGGAACCAGGAAGGGG + Intronic
1048968222 8:139629199-139629221 GCCACCTGGTGAGGTCGCTGTGG - Intronic
1049009181 8:139875906-139875928 GCTACCTGGGAAGGAGGCAGAGG + Intronic
1049267627 8:141677531-141677553 GCCACCTTGAAAGCTAGCATGGG - Intergenic
1049388274 8:142355080-142355102 GCCACCTGGGAGGCTGGCGGTGG - Intronic
1049552331 8:143266379-143266401 GCCACCTGGCAAGTGTGCAGTGG + Intronic
1049860289 8:144893670-144893692 GTCCCCTGGAAACCTGGCAGAGG + Intronic
1049928537 9:433275-433297 GAGCCCTGGCAAGCTGGCAGAGG + Intronic
1049936073 9:503346-503368 GCCACCCAGTGAGCTGGCAAAGG + Intronic
1056607507 9:88098681-88098703 GCCACCTGGAAAGCAAACAGTGG - Intergenic
1057889392 9:98857237-98857259 GCCTCCTGCTAAGATGGCTGAGG + Intergenic
1058485880 9:105443082-105443104 GCCAAGTGGTAAGCAGTCAGTGG - Intergenic
1061190709 9:129081119-129081141 GTCTCCGGGTAAGATGGCAGCGG + Exonic
1061798395 9:133101505-133101527 GCATCCTGGTAAGCCGGCGGGGG - Exonic
1203438412 Un_GL000195v1:165187-165209 CCCACCTGGTTAGCTGGCAAAGG - Intergenic
1189430853 X:40945882-40945904 GCCACCTTGAAAGATGTCAGGGG + Intergenic
1189961479 X:46328400-46328422 GCCACATGGAAAGCCAGCAGGGG + Intergenic
1190001437 X:46691823-46691845 GGCACCTGGGAAGCTGCTAGAGG - Intronic
1192594488 X:72392268-72392290 GCCACCTGGTAAGCTGGCAGGGG - Intronic
1194893007 X:99403753-99403775 GCAACCTGCTAATCTGGCAAAGG + Intergenic
1196620302 X:117814898-117814920 GCCACCTGGGTAGCTGGGACTGG - Intergenic
1197648572 X:129041965-129041987 ACCTGCTGGTCAGCTGGCAGTGG - Intergenic
1197786309 X:130200633-130200655 GCCACCTGGGTATCTGTCAGAGG - Intergenic
1200134981 X:153870423-153870445 GCCACCTGGTGGCCTTGCAGGGG - Exonic
1202383853 Y:24304351-24304373 GCCAACTGGCATGCTGTCAGTGG - Intergenic
1202486930 Y:25365769-25365791 GCCAACTGGCATGCTGTCAGTGG + Intergenic