ID: 1192604335

View in Genome Browser
Species Human (GRCh38)
Location X:72499224-72499246
Sequence AACACAGATGTACTAAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 1, 2: 10, 3: 63, 4: 270}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192604332_1192604335 3 Left 1192604332 X:72499198-72499220 CCCAGACTCAGGTATTCCTTTAA 0: 1
1: 30
2: 857
3: 3665
4: 10610
Right 1192604335 X:72499224-72499246 AACACAGATGTACTAAGACAAGG 0: 1
1: 1
2: 10
3: 63
4: 270
1192604333_1192604335 2 Left 1192604333 X:72499199-72499221 CCAGACTCAGGTATTCCTTTAAA 0: 1
1: 32
2: 881
3: 3533
4: 7329
Right 1192604335 X:72499224-72499246 AACACAGATGTACTAAGACAAGG 0: 1
1: 1
2: 10
3: 63
4: 270
1192604330_1192604335 23 Left 1192604330 X:72499178-72499200 CCTCTTTTCTTTATAAATTACCC 0: 3806
1: 9545
2: 9195
3: 5640
4: 5267
Right 1192604335 X:72499224-72499246 AACACAGATGTACTAAGACAAGG 0: 1
1: 1
2: 10
3: 63
4: 270
1192604329_1192604335 30 Left 1192604329 X:72499171-72499193 CCAAATACCTCTTTTCTTTATAA 0: 2
1: 5
2: 33
3: 125
4: 707
Right 1192604335 X:72499224-72499246 AACACAGATGTACTAAGACAAGG 0: 1
1: 1
2: 10
3: 63
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192604335 Original CRISPR AACACAGATGTACTAAGACA AGG Intronic
901786024 1:11625498-11625520 AACACAAATGGACTAATTCACGG - Intergenic
902270798 1:15303139-15303161 AACACAACTGTAAGAAGACAAGG - Intronic
906730061 1:48073109-48073131 AGCACAAATGGACTAAGACAGGG + Intergenic
906776691 1:48536219-48536241 AAAAAGGATGTACAAAGACATGG + Intronic
907775896 1:57514578-57514600 AACAAAGATATACTAAGTAAAGG + Intronic
908964826 1:69747330-69747352 AACACAAATGTGCAAAGGCATGG + Intronic
909878811 1:80847267-80847289 AGCACAAATGGACCAAGACATGG - Intergenic
910517609 1:88080151-88080173 AACACAATGGTACTAACACAGGG + Intergenic
910645941 1:89515229-89515251 AAAACAAATGGACTAAAACAAGG + Intergenic
911346844 1:96707403-96707425 AACACAGATGTCCTATGATCAGG - Intergenic
911671473 1:100613396-100613418 AACATAAATGGACTAAGACAAGG + Intergenic
914994528 1:152530938-152530960 AACAAAGATGAAAAAAGACAAGG - Intronic
915864141 1:159479900-159479922 AATACTGATGCACTTAGACATGG - Intergenic
917148325 1:171916901-171916923 AAATCAGATATACGAAGACATGG - Intronic
918622683 1:186623366-186623388 AGCACAAATAGACTAAGACAAGG + Intergenic
920016080 1:202910089-202910111 AACACTTATGTACAAAGACTTGG + Intronic
920670021 1:207996571-207996593 AACACAGAATTAGAAAGACAAGG - Intergenic
921092083 1:211853626-211853648 AACAAAGATAGACTGAGACACGG - Intergenic
921998374 1:221446996-221447018 AACACAGACGAGCTAGGACAGGG + Intergenic
923150231 1:231226502-231226524 AACAAAAACGGACTAAGACAAGG + Intronic
924051712 1:240085930-240085952 AAGACAGATGCTCTAAGACAGGG + Intronic
924397405 1:243636854-243636876 AAAACAAATGTACAAAGACAGGG + Intronic
1064304636 10:14154061-14154083 AACACAGATGGTTTAAGACAGGG - Intronic
1064531165 10:16311652-16311674 AAATCAAATGGACTAAGACATGG - Intergenic
1065291365 10:24233171-24233193 ATCACAAATGGACTAAGAGAGGG - Intronic
1065299954 10:24312223-24312245 AAAACAGATATACACAGACATGG + Intronic
1066250072 10:33624708-33624730 AACACAAAAGGACCAAGACAAGG - Intergenic
1067123572 10:43495995-43496017 AACACAGATGTACTTTTTCAGGG + Intergenic
1067549463 10:47223663-47223685 AACACAGCTCCTCTAAGACAGGG - Intergenic
1068178220 10:53489312-53489334 AACACAAACAGACTAAGACAAGG - Intergenic
1068753441 10:60623294-60623316 CACAGAGATGTACAAAGAAAGGG + Intronic
1069179470 10:65340005-65340027 AACACAGATTTTCCAAGATACGG - Intergenic
1069627194 10:69875593-69875615 GACAGAGATGCACTAAGAGATGG + Intronic
1071002267 10:80843244-80843266 AACACAAATTGACAAAGACAGGG + Intergenic
1071177213 10:82940545-82940567 AGCCCAGATGGACTAAGAAAGGG - Intronic
1072362596 10:94674405-94674427 AGCCCAAATGGACTAAGACAGGG + Intergenic
1072442488 10:95469314-95469336 AATACAGATTTAGTCAGACATGG - Intronic
1072932052 10:99673776-99673798 AATAGAGCTGTACAAAGACACGG + Intronic
1073698384 10:105895815-105895837 AACAAAGATGAAAAAAGACAAGG + Intergenic
1073960485 10:108921295-108921317 AGCAGAAATGGACTAAGACAGGG + Intergenic
1075183362 10:120232436-120232458 AGCACAAATGGACTGAGACAGGG + Intergenic
1075352665 10:121738074-121738096 AACACTGTGGTACTATGACAGGG - Intergenic
1075528099 10:123202843-123202865 GACACAGGTGTGGTAAGACATGG + Intergenic
1075608757 10:123835098-123835120 AACACCAATGGACTAAGACATGG + Intronic
1076132936 10:128026246-128026268 AACACAGATGGATGAGGACAGGG - Intronic
1076239907 10:128896959-128896981 AACACAGAGGAATTAAGTCAGGG - Intergenic
1078249650 11:9606693-9606715 GACACAGATGTAATGAGATAAGG + Intergenic
1080665722 11:34334227-34334249 AAAACAGTTGAACAAAGACAGGG - Intronic
1080824019 11:35832768-35832790 AGCCCAAATGGACTAAGACAGGG + Intergenic
1082823062 11:57557782-57557804 AACACTAATGGACTAAGACAGGG + Intronic
1085625439 11:78068345-78068367 AATAAAGATGTACAAATACAAGG - Exonic
1086263530 11:84970404-84970426 AGCCCAAATGGACTAAGACAGGG - Intronic
1086532916 11:87807318-87807340 GACACAGATGACCTAATACAAGG + Intergenic
1086730529 11:90243176-90243198 AACACAGAGGAACTTAGGCACGG - Intergenic
1087426686 11:97996619-97996641 TACACAGATGTTCCAAGAAATGG - Intergenic
1088314067 11:108489479-108489501 AACACAGATGAACAAAGATAAGG + Intronic
1088488892 11:110368043-110368065 AACACAAATGAAGTAATACAGGG - Intergenic
1089397091 11:118143299-118143321 AACAGAGATGGAGTAAGACATGG - Intronic
1089546204 11:119227918-119227940 GACACAGAAGTAAAAAGACAAGG - Intronic
1089829273 11:121310940-121310962 AGTACAAATGGACTAAGACAAGG + Intergenic
1090039483 11:123277714-123277736 AACACAAATGGACTAAGGCAGGG - Intergenic
1090324928 11:125877170-125877192 AACAAAGAAGTATCAAGACAAGG + Intergenic
1091322708 11:134663291-134663313 AGCACAGATTTACTAAGGCAAGG - Intergenic
1091659911 12:2375705-2375727 AAGATACATATACTAAGACAAGG - Intronic
1091693348 12:2611688-2611710 AACACAGATGTGTTCAGAGATGG + Intronic
1094417789 12:30235706-30235728 AACATAGATTTACCAACACAGGG + Intergenic
1095176996 12:39103975-39103997 AACACTGATCCACTAAGACATGG + Intergenic
1095662920 12:44758952-44758974 AACATAGATGGCCTCAGACATGG + Intronic
1095816720 12:46430892-46430914 GACCCAGATGTAGTAATACATGG - Intergenic
1096335213 12:50750079-50750101 AACACAAAAGGACTAAGATAAGG + Intergenic
1096755929 12:53799512-53799534 AACACAAATGGACTAACATAGGG - Intergenic
1096984604 12:55748100-55748122 AACACAGATGGCCTCAGAGAGGG - Intronic
1097650847 12:62295776-62295798 AACACAGATAGATTAAGATATGG + Intronic
1097659780 12:62416810-62416832 AATACAGTTGTCCAAAGACAAGG + Intronic
1098231134 12:68373008-68373030 AAAACAGATGAACACAGACAAGG + Intergenic
1098548610 12:71738664-71738686 AGCACAGGTGGACTAAGACAAGG - Intergenic
1101022451 12:100567010-100567032 AAAACATATGGACTAAGAGATGG - Intergenic
1102513340 12:113430209-113430231 AACACAGAGATAGTAAGACATGG + Intronic
1104495396 12:129232276-129232298 AACACACATGCACTCAGACATGG + Intronic
1106536117 13:30644433-30644455 AACTCAGATCTACTAGAACAGGG + Intronic
1106837550 13:33651030-33651052 AACACTCATGGACTAAGACAAGG + Intergenic
1106989029 13:35394069-35394091 GACACAGATGTACTAAGTGTGGG + Intronic
1107955927 13:45511269-45511291 AACATAAATGTTCAAAGACAGGG - Intronic
1108224580 13:48275120-48275142 ATCACAGATCTACAAACACAGGG + Intergenic
1109428247 13:62197343-62197365 AGCACAAAGGGACTAAGACAGGG - Intergenic
1110788695 13:79562912-79562934 AACAAAGATGAAAAAAGACAAGG + Intergenic
1110928141 13:81181823-81181845 AACACAGAGTTACAAAGAAAAGG - Intergenic
1111421896 13:88021965-88021987 GTTCCAGATGTACTAAGACATGG - Intergenic
1112392429 13:98997759-98997781 AACAAAGATGCACAAAGTCAGGG - Intronic
1113189630 13:107729127-107729149 AAAACAGATGCATTCAGACATGG - Intronic
1114738133 14:25063956-25063978 AACCCAAATGGACTAAGGCATGG + Intergenic
1115250196 14:31337131-31337153 CACACAGCTGTACTAACATAGGG + Intronic
1115922243 14:38388628-38388650 AACACAGAAAGACTAAGAAATGG + Intergenic
1116734894 14:48676739-48676761 AACACACATGTACATAAACAGGG + Intergenic
1117426979 14:55610077-55610099 ACCCTAGATTTACTAAGACAAGG - Intronic
1118240161 14:64048512-64048534 AACACAGATGTAAAAACAAAGGG - Intronic
1119732015 14:76957038-76957060 AACACAGATGCCCACAGACAGGG - Intergenic
1120589437 14:86357935-86357957 AAGAGAGATGTACTGAGACAAGG + Intergenic
1122040001 14:98980440-98980462 AGCCCAAATGAACTAAGACAGGG + Intergenic
1122569393 14:102684227-102684249 AAGACAGATGAACTAAGCAAGGG + Intronic
1123430190 15:20208360-20208382 AACACTGAGGTACCCAGACAAGG + Intergenic
1124072358 15:26407462-26407484 AACTCAGATGAACTAAGATACGG - Intergenic
1125772621 15:42180151-42180173 TGCACAAATGAACTAAGACATGG + Intronic
1126998124 15:54468794-54468816 AAAACAGATATACTAAGCAATGG - Intronic
1128042449 15:64587238-64587260 CACTGAGATGTACAAAGACAAGG - Intronic
1129221114 15:74132152-74132174 AACACATATGCACCCAGACATGG - Intronic
1129935792 15:79449347-79449369 AACACAAACATACTAAGATAGGG - Intronic
1130562827 15:84971992-84972014 AATACAAATGGACTAAGACATGG + Intergenic
1131475515 15:92735320-92735342 GGCACAAATGGACTAAGACAGGG - Intronic
1131591108 15:93749062-93749084 AACAAAGATTTAAAAAGACAAGG + Intergenic
1131772182 15:95750442-95750464 AACAAAAATGGACTAAGACAAGG - Intergenic
1133253826 16:4503814-4503836 AACACAGAAGTGTTAAGAAATGG - Intronic
1133467796 16:6044461-6044483 AAAACAGGTCTTCTAAGACAAGG - Intronic
1133821495 16:9241154-9241176 AACACAAAAGGACTAAGACAGGG + Intergenic
1136632040 16:31494584-31494606 TACACATATGTATTTAGACAGGG - Intronic
1136854447 16:33642847-33642869 AACACTGAGGTACCCAGACAAGG - Intergenic
1138144117 16:54593873-54593895 ATCACAGATGTATTTATACAGGG - Intergenic
1139320844 16:66112516-66112538 AACATAAATGGGCTAAGACAGGG + Intergenic
1203116026 16_KI270728v1_random:1491305-1491327 AACACTGAGGTACCCAGACAAGG - Intergenic
1142559557 17:802081-802103 AACACAGAAATCCAAAGACAAGG + Intronic
1145096510 17:20033407-20033429 AAGACAAATGAACCAAGACAGGG - Intronic
1146556225 17:33826658-33826680 AGCACAGAGGTAATAAGGCATGG - Intronic
1146928182 17:36759360-36759382 AGCACAAGTGGACTAAGACACGG + Intergenic
1149265706 17:54925396-54925418 AACACAGAAGCAAGAAGACAGGG + Intronic
1149372888 17:56012928-56012950 AACACAAATGAACTAAGACTGGG - Intergenic
1150578434 17:66450788-66450810 AAGACAAATGTACTAGTACAGGG - Intronic
1153061895 18:1003644-1003666 AATGCAAATGGACTAAGACATGG - Intergenic
1153270800 18:3319193-3319215 CACTCAGATGTACTATAACATGG + Intergenic
1155913429 18:31532088-31532110 AGCTCAAATGGACTAAGACAGGG - Intronic
1158235506 18:55308596-55308618 TACAAAGATGCATTAAGACATGG + Intronic
1158429863 18:57375620-57375642 CACTCAAATGGACTAAGACATGG + Intergenic
1158812017 18:61048856-61048878 AACACAGAAGCACAAAGTCATGG + Intergenic
1158839161 18:61364850-61364872 AACACCAGTGGACTAAGACACGG + Intronic
1160053785 18:75460988-75461010 AGCCCAAATGGACTAAGACAGGG - Intergenic
1160802515 19:976903-976925 ACCACAGATGTCCCCAGACATGG - Intergenic
1161028424 19:2047212-2047234 ACCACAGATGTCCCCAGACATGG - Intronic
1161155184 19:2728856-2728878 ACCACAGATGTCCCCAGACATGG + Intronic
1161265787 19:3363752-3363774 ACCACAAATGTCCTTAGACATGG - Intronic
1161323154 19:3650456-3650478 ACCACAGATGTCCCCAGACATGG - Intronic
1161480310 19:4507062-4507084 ACCACAGATGTCCCCAGACATGG + Intronic
1163163212 19:15477994-15478016 AGCACCAATGTACTAAGACAGGG - Intronic
1164817178 19:31213490-31213512 TACACAAATGTACAAAGACATGG - Intergenic
1165521315 19:36316523-36316545 AACACAAACGGACTAAGAGAGGG - Intergenic
1165622746 19:37262065-37262087 AACACAAACGGACTAAGAGAGGG + Intergenic
1165634446 19:37328696-37328718 AACACAAACAGACTAAGACAGGG + Intronic
1167114650 19:47481798-47481820 AACACAGATGGTCTAGAACAGGG - Intronic
1167393962 19:49215053-49215075 AACAGAGATGAATTAATACACGG - Intergenic
1167735055 19:51289238-51289260 AGCCCAGATGGACTAAGACAGGG - Intergenic
1168439619 19:56352808-56352830 AACACAGATGTCCAAAGTCCAGG + Intronic
927330318 2:21855027-21855049 AACACAGAAGTAGTATAACATGG - Intergenic
927725823 2:25422071-25422093 AACACAGAGGTTCTCAGACCTGG - Intronic
931192898 2:60022845-60022867 TACACAAATGTTCCAAGACAAGG + Intergenic
932460197 2:71877130-71877152 AATACAGCTGTACTAAAAGATGG + Intergenic
932792185 2:74663439-74663461 AACACAAATGGACGAATACAGGG - Intronic
933057446 2:77689827-77689849 AACACAAATGGACTAAGATAGGG + Intergenic
933112684 2:78423846-78423868 AGCACAAATGGACTAAGACATGG + Intergenic
933534868 2:83558806-83558828 AATACTGATTTAGTAAGACATGG + Intergenic
933650091 2:84843489-84843511 AGCACAAATGGACTGAGACAAGG - Intronic
933927586 2:87111017-87111039 AACACAAATGGACTAAGATAGGG + Intergenic
934987191 2:98896057-98896079 AACTCAAATGGACTAAGACAGGG + Intronic
936778209 2:115999488-115999510 AGCACAGATGGATTAAGACAGGG - Intergenic
939651123 2:144763146-144763168 AGCACAAATGGACAAAGACAAGG + Intergenic
940305713 2:152224095-152224117 AACACAGCTGTATTAAGAGGAGG - Intergenic
940771637 2:157845035-157845057 AGTACAAATGGACTAAGACAAGG + Intronic
941841621 2:170091404-170091426 AACAGAAATGTAATAAGACGGGG + Intergenic
943468257 2:188257734-188257756 AACACAAAAGCACTAACACATGG + Intergenic
944135489 2:196394817-196394839 AACACAAAGGGACTAAGACATGG - Intronic
944298500 2:198094507-198094529 AAGTAAGATGTGCTAAGACAGGG - Intronic
944993310 2:205263133-205263155 AACACAGATGAGCTTAGAAAAGG - Intronic
945212095 2:207394408-207394430 AACACAAAAGTCCTAAGTCAAGG + Intergenic
946628460 2:221640863-221640885 AGCACAAATAGACTAAGACAAGG - Intergenic
946652707 2:221910978-221911000 AGCCCAAATGGACTAAGACAAGG - Intergenic
948015858 2:234690116-234690138 AACACTGATGTAAACAGACAGGG - Intergenic
949011394 2:241681118-241681140 ATCACAGATGTACAAAGACACGG + Intronic
1168736750 20:146768-146790 CAGAAAGATGTACTATGACAGGG - Intergenic
1172792240 20:37513772-37513794 CACACAGAGGTACTGAGATATGG + Intronic
1174192078 20:48747766-48747788 AACACAGATGCTCTAGAACAGGG + Intronic
1175914747 20:62420544-62420566 AACACATATGTACACAGACAGGG + Intronic
1176258854 20:64168489-64168511 AAGGCAGATGTACTCAGCCAGGG - Intronic
1176728977 21:10470880-10470902 AACACACATGCACAAAGCCAGGG - Intergenic
1176908070 21:14528458-14528480 AAGGCAGATGTACTAAAAAAAGG + Intronic
1178310321 21:31524856-31524878 AGCACAAATGTACTAAGACAAGG - Intronic
1178968259 21:37145596-37145618 AACACAAATGGACTGAGACATGG - Intronic
1179885249 21:44311389-44311411 CACACAGATGCACACAGACATGG + Intronic
1179966712 21:44811177-44811199 CACACACATGCACAAAGACACGG + Intronic
1180686195 22:17668939-17668961 AATATAAATGAACTAAGACAAGG - Intronic
1181189814 22:21130049-21130071 AATACAGATTTAATCAGACATGG + Intergenic
1181209390 22:21280456-21280478 AATACAGATTTAATCAGACATGG - Intergenic
1181443001 22:22947777-22947799 AGCCCAAATGGACTAAGACATGG - Intergenic
1181893992 22:26090140-26090162 AAGACAGACATAATAAGACAGGG - Intergenic
1182168359 22:28200437-28200459 AATTCAGATGTATTAAGACTAGG - Intronic
949939090 3:9140520-9140542 AACACCTATGTGCTAAGCCAAGG + Intronic
951155416 3:19347099-19347121 GACACAGATGCACTCTGACATGG - Intronic
951462198 3:22963426-22963448 AGCCCAAATGGACTAAGACATGG + Intergenic
952480707 3:33758924-33758946 AATACAGAGGTAATAAAACATGG - Intergenic
952573019 3:34740671-34740693 AAATCAGATGTACTATGTCATGG + Intergenic
952686226 3:36151682-36151704 AACACAAACAGACTAAGACAAGG - Intergenic
954824553 3:53361304-53361326 AACTCAGATGGACTAAGACAGGG - Intergenic
956226049 3:66959864-66959886 AACCCAGATGAATGAAGACAAGG - Intergenic
956699415 3:71945592-71945614 AACACACATGTTCTCAGAAAGGG - Intergenic
956734679 3:72229105-72229127 ATCACAAATGGACTAAGACAGGG + Intergenic
957235893 3:77590501-77590523 CACAGAGATGTAATATGACATGG - Intronic
957291668 3:78285047-78285069 ACCACAAATGGACTAAAACAAGG - Intergenic
959441162 3:106376998-106377020 AAGAAAGATGTACTATGACAGGG - Intergenic
959483091 3:106897261-106897283 AAAACAGATGTATTAAGAAAAGG + Intergenic
959825531 3:110791503-110791525 AACACAGATGAACTGAGAAAAGG - Intergenic
960357848 3:116675639-116675661 AAAACAGAAGAACCAAGACAAGG - Intronic
960503852 3:118469763-118469785 AACACAGACAGACTAAGACTGGG - Intergenic
960685857 3:120292790-120292812 AACAGAGATTTAAAAAGACAAGG + Intergenic
961927394 3:130495806-130495828 AACACAAATGGACTAAGACAAGG - Intergenic
962886993 3:139636960-139636982 TACACAAATGTAGTAGGACATGG - Intronic
963163422 3:142175902-142175924 AAGACAGACTTGCTAAGACAAGG + Intronic
963262616 3:143208033-143208055 AACCCATACGGACTAAGACAGGG - Intergenic
964430528 3:156601456-156601478 GACACAGATGTACTTAGACTTGG + Intergenic
964433943 3:156632976-156632998 AACACAAATGGACTAAAACAGGG + Intergenic
965003860 3:162990882-162990904 AGCAGAAATGGACTAAGACATGG - Intergenic
965313709 3:167164047-167164069 AGCACAGACAGACTAAGACATGG - Intergenic
965950087 3:174298400-174298422 AACACATATGTACATAGAAAAGG - Intergenic
967502584 3:190217105-190217127 AACACAGATGGACTAAGACAAGG + Intergenic
970680789 4:18505484-18505506 AACACACATGGACAAAAACATGG - Intergenic
971012084 4:22449417-22449439 AAAACTGAAGTGCTAAGACAGGG + Intronic
972135064 4:35882447-35882469 AATACTGAAGTAATAAGACAAGG - Intergenic
972992639 4:44840751-44840773 AACATACATGGACTAAGAGATGG - Intergenic
974093429 4:57336071-57336093 AACACAAATGTACAAAGCCCAGG - Intergenic
974252188 4:59400613-59400635 AACACAGATGTAATTAATCAAGG - Intergenic
974255359 4:59446692-59446714 AACACAGAGGTCCAATGACATGG + Intergenic
974687458 4:65248275-65248297 AGCACAAATGGACTAAGACATGG + Intergenic
975162132 4:71136148-71136170 GACACAGAAGTATTAAAACAGGG - Intergenic
975721980 4:77256856-77256878 AGAACACATGTTCTAAGACAAGG - Intronic
976589437 4:86834403-86834425 AACTCACATGGGCTAAGACAAGG + Intronic
977868666 4:102062553-102062575 ATCACAGATGTGCTAAGAAGAGG + Intronic
977923937 4:102677655-102677677 CACACAGATGTACTTGGAAAAGG - Intronic
979446885 4:120824159-120824181 AACACAAATGGACTAAGACAAGG + Intronic
979906283 4:126297987-126298009 AACAGAGATGTACAAATGCAGGG + Intergenic
980020194 4:127700003-127700025 AACATAGATGGAATTAGACATGG + Exonic
981676771 4:147351654-147351676 AGCGCAAATGAACTAAGACAGGG - Intergenic
981750693 4:148090483-148090505 GACACATATGTACTAAGAAAAGG + Intronic
982293558 4:153804183-153804205 GATACAAATGGACTAAGACAGGG - Intergenic
982471514 4:155796721-155796743 TCCACAAATGTATTAAGACATGG - Intronic
984348981 4:178567877-178567899 AACACAAATGTGCTGAAACAAGG - Intergenic
986182235 5:5404038-5404060 AACACAGATGGCATAAGAAAAGG + Intergenic
987808696 5:22804805-22804827 ATCACAGATGGACTAAGATTAGG + Intronic
988488205 5:31684815-31684837 AACACAGATGATCTAGGACAAGG - Intronic
988930276 5:36030281-36030303 AAAACATATGTATTAAGATATGG - Intergenic
989194410 5:38702009-38702031 AACACAGATCAAAAAAGACAAGG + Intergenic
990393298 5:55350418-55350440 AACAAAGATGTATAAAAACATGG - Intronic
991943314 5:71876052-71876074 AGCCCAAATGGACTAAGACAAGG + Intergenic
993155067 5:84212180-84212202 AACACAAATGAACTAAGGAAAGG + Intronic
994819605 5:104632561-104632583 AAGACAAATGTAATAAGACATGG + Intergenic
995535420 5:113130900-113130922 AACACAAAGGGACTAAGACAGGG + Intronic
998646916 5:144072251-144072273 AACACAGATCCACTAGGCCAGGG - Intergenic
1000046172 5:157523741-157523763 AACACAAATGGACTAATACAGGG + Intronic
1000153557 5:158527888-158527910 CACACAGATGAAGGAAGACATGG - Intergenic
1000786235 5:165547643-165547665 AAAACAGAGATACTAATACATGG + Intergenic
1001457617 5:171877019-171877041 AATACAAATGGAGTAAGACAGGG + Intronic
1004116164 6:12770209-12770231 AAAACAGATGTATTAATACCTGG - Intronic
1005531865 6:26715750-26715772 AACATAGAAGAATTAAGACAAGG + Intergenic
1005538930 6:26785915-26785937 AACATAGAAGAATTAAGACAAGG - Intergenic
1006403386 6:33830678-33830700 AACACAGGGGTGCTAAGTCATGG - Intergenic
1007083835 6:39128602-39128624 AAAACAAATGGATTAAGACAAGG - Intergenic
1008007114 6:46422433-46422455 AACACAAATGGACTAAGACAGGG + Intronic
1008418932 6:51274045-51274067 ATCCCAGATGAACTAGGACAAGG + Intergenic
1008420605 6:51294766-51294788 AGCACAAATAGACTAAGACAAGG + Intergenic
1008533368 6:52485881-52485903 AACACAAATGGACTACGACATGG + Intronic
1009009771 6:57828142-57828164 AACATAGAAGAATTAAGACAAGG - Intergenic
1009360646 6:62807377-62807399 AACACAAATAGACTAAGACAGGG + Intergenic
1009484273 6:64199958-64199980 AACTGTGATGTACTAAGACAAGG + Intronic
1009956110 6:70455567-70455589 AACATAGAGGTAATAAAACAAGG + Intronic
1010003216 6:70969073-70969095 AACACATATGTATTAATACCTGG + Intergenic
1012836927 6:104281028-104281050 ATCACAGACGTACTGAGAGATGG - Intergenic
1012968052 6:105696859-105696881 AACCCAGGTGTTCAAAGACATGG + Intergenic
1013875086 6:114815751-114815773 AACAAAAATGAACTAATACATGG + Intergenic
1014981548 6:127951719-127951741 ATCACAGATGTTATAAGAGATGG - Intergenic
1015285973 6:131486964-131486986 AACACAAACAGACTAAGACAGGG - Intergenic
1015969146 6:138726902-138726924 TACACACTTGTACCAAGACAAGG + Intergenic
1015999790 6:139030369-139030391 AACACAGAAGAAATAAGACCTGG - Intronic
1017455473 6:154597463-154597485 AACACAAACGGACTAAGACAGGG + Intergenic
1018603525 6:165573477-165573499 CTCATAGATTTACTAAGACAGGG + Intronic
1020577480 7:9951930-9951952 AACATAGATGCACAAATACAAGG + Intergenic
1020999966 7:15316453-15316475 AACAAAGATCTACTCAGTCAAGG + Intronic
1021169091 7:17376287-17376309 TACACAGATGTACTAACCCATGG - Intergenic
1021588716 7:22237818-22237840 AACACAGAGGTACTAAGTAATGG + Intronic
1021863678 7:24932771-24932793 AGCCCAAATGGACTAAGACAGGG + Intronic
1023025046 7:36042460-36042482 CACACAGAAGTGCTCAGACAGGG - Intergenic
1023200769 7:37694533-37694555 AACACAAATGGACTAAGACAGGG - Intronic
1023957040 7:44894820-44894842 AACACAGATGTACTTGGATGAGG + Intergenic
1026325545 7:69306192-69306214 AACACAAATGGACTAAGACAGGG + Intergenic
1030749290 7:113210832-113210854 AGCACAAATGTACTGAGACAAGG - Intergenic
1031690163 7:124778181-124778203 AACACCCATGTCCTAAGGCATGG + Intronic
1031930368 7:127679403-127679425 AACACAGAAGTACAAAAACATGG - Intronic
1031941024 7:127789400-127789422 AACTCAGATTTAATCAGACAGGG - Intronic
1033808436 7:144980980-144981002 AACACAAATGAACCAAGACAAGG + Intergenic
1033875297 7:145810360-145810382 AACACAGAAATTCTGAGACATGG + Intergenic
1034313264 7:150108813-150108835 AACACAAAGGGACTAAGACAGGG + Intergenic
1034398941 7:150848647-150848669 AAAATAGAGGTACTGAGACAAGG + Intronic
1034793597 7:153991855-153991877 AACACAAAGGGACTAAGACAGGG - Intronic
1036449749 8:8855303-8855325 AAAACAGATGAATTAAGACATGG + Intronic
1036587589 8:10138771-10138793 AGCACAGTTGTACTAAGATAAGG - Intronic
1037650317 8:20831576-20831598 TGCAAAGATGTACTAAGACATGG - Intergenic
1037766190 8:21773838-21773860 AACAAAGATGTCCCCAGACAGGG - Intronic
1037843103 8:22259604-22259626 CAGCCAGATGGACTAAGACAGGG + Intergenic
1038348021 8:26749977-26749999 AGCCCAAATGAACTAAGACAAGG - Intronic
1038856949 8:31344298-31344320 AACACAAATGGACTAAGACATGG + Intergenic
1038867194 8:31452206-31452228 AGCACAAATGGACTAAGGCATGG + Intergenic
1038895499 8:31777553-31777575 AACACAAATGAACTAAGAACAGG - Intronic
1039247627 8:35627044-35627066 AACACCCATCTACTAAGAAATGG + Intronic
1039401771 8:37275919-37275941 ATTACAGAGGTACTCAGACATGG - Intergenic
1043781293 8:84339198-84339220 AACCTAGATGTACTAGAACAGGG + Intronic
1046104481 8:109649306-109649328 AACACACATACATTAAGACAAGG - Intronic
1046144246 8:110136628-110136650 AACACAGAAGTAGGAAGCCATGG - Intergenic
1047446331 8:124923461-124923483 AAAACAGATGTGCTTAGGCATGG + Intergenic
1047579480 8:126197642-126197664 AACACAGCTCTACTAGGATATGG - Intergenic
1049720351 8:144112718-144112740 AACACAGCTGTACTGGAACAGGG - Intronic
1050319191 9:4433705-4433727 AACACAGATGGGCTCTGACAAGG - Intergenic
1050391034 9:5144731-5144753 AACAAAGATTTAAAAAGACAGGG - Intronic
1050588045 9:7133695-7133717 AACACAGATCCAGTAGGACATGG + Intergenic
1050706050 9:8398889-8398911 AGCACAAATGGACTAAGACATGG + Intronic
1050801635 9:9622706-9622728 AACATAGATATATTAAGGCAAGG + Intronic
1051425388 9:16927020-16927042 TACGAAGATGTAATAAGACAAGG + Intergenic
1051433616 9:17006775-17006797 AACAGACATGTACTTAGAGAGGG - Intergenic
1052587936 9:30452900-30452922 GGCCCAAATGTACTAAGACAGGG - Intergenic
1052833583 9:33234327-33234349 GACACAGATGACCTAAAACAGGG - Intronic
1055188339 9:73485218-73485240 AGCCCAGATGCACAAAGACAAGG + Intergenic
1055376702 9:75656185-75656207 AGCACAAATGGACTAAGACAGGG + Intergenic
1056259538 9:84833973-84833995 AAGTCAAATGAACTAAGACATGG - Intronic
1056375169 9:86001630-86001652 AACAAAGATCAAATAAGACAAGG - Intronic
1059358118 9:113717128-113717150 AGCACAAATGGACAAAGACAGGG + Intergenic
1060507194 9:124206867-124206889 GACACGGAGGTACTAAGACATGG + Intergenic
1061472356 9:130836288-130836310 AAAACAGATGTAATTAGAGAAGG - Intronic
1061752915 9:132793068-132793090 AGCCCAAATGGACTAAGACAGGG - Intronic
1203585271 Un_KI270746v1:63190-63212 AACACACATGCACAAAGCCAGGG + Intergenic
1187103237 X:16216425-16216447 AACACAAATGGACTAAGACATGG - Intergenic
1187284593 X:17892698-17892720 AACCCAGATGTCCTACCACAGGG + Intergenic
1188952269 X:36390682-36390704 AACACCAATGTAGTAAGACAAGG + Intergenic
1189963610 X:46349659-46349681 AGCAAAAATGAACTAAGACAGGG - Intergenic
1192604335 X:72499224-72499246 AACACAGATGTACTAAGACAAGG + Intronic
1192846635 X:74912649-74912671 GGCACAGATGGAATAAGACAAGG - Intronic
1192980225 X:76331427-76331449 AACAAAGATCAAATAAGACAAGG - Intergenic
1193961257 X:87927234-87927256 AACAAAGATTTAAAAAGACAAGG + Intergenic
1197098098 X:122619583-122619605 AACACAGATGAAAAGAGACAAGG - Intergenic
1197162105 X:123335528-123335550 AATACAGATGTATTAAATCAAGG + Intronic
1199751754 X:150826280-150826302 AGCACAAATGGACTAATACAGGG + Intronic
1200048673 X:153416700-153416722 AACACAGGAGGACTAGGACAGGG - Intergenic
1200864862 Y:8032828-8032850 AACACAGGTGTACCAGGCCAAGG - Intergenic
1200895626 Y:8373227-8373249 AACCCAGAGGTACTAGGCCAAGG + Intergenic