ID: 1192606833

View in Genome Browser
Species Human (GRCh38)
Location X:72527321-72527343
Sequence CAGGCCTTTCTGAAGTATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192606833 Original CRISPR CAGGCCTTTCTGAAGTATTG AGG (reversed) Intronic
902154322 1:14471789-14471811 CATGCCTTTCTGAACACTTGTGG - Intergenic
905262568 1:36729992-36730014 CTGGCCCTTCTGAGGCATTGGGG - Intergenic
905684038 1:39896221-39896243 TGGGCGTTTCTGAAGTTTTGGGG - Exonic
905897056 1:41555120-41555142 CAGGCCTTGCTGAACTGTTGTGG + Intronic
906505884 1:46379318-46379340 CTGGCCCTTCTCAAGTATTTTGG - Intergenic
906951783 1:50340864-50340886 CAGGCCTTTCCCAGGTACTGGGG + Intergenic
911017751 1:93352403-93352425 AATGCCTTTCTGAAGTTTTTAGG + Intronic
913205895 1:116538393-116538415 CAGGCATTTTTGAACTATTCTGG - Intronic
914441515 1:147711680-147711702 CAGGCCTTGCTGAACTGTGGTGG + Intergenic
915591928 1:156875645-156875667 CAGGCATCACTGAAGTATTGTGG - Exonic
918254782 1:182739490-182739512 CTGGCATTTATGAAGAATTGGGG + Intergenic
919100194 1:193086753-193086775 ATGACCTTTCTGAAGTATTTAGG + Intronic
920593049 1:207241008-207241030 CAGGCCTGTCTGTATTCTTGAGG + Intergenic
922003328 1:221503454-221503476 CCGGCCTCTCTCAAGTACTGGGG - Intergenic
924629011 1:245719755-245719777 CAGGCTTTTCTGAAGGAAAGAGG - Intergenic
1063033150 10:2256335-2256357 CAGGCATTTCTGAAGGCTTTTGG + Intergenic
1065171470 10:23034751-23034773 CAGGTCTCTCTTAAATATTGGGG + Intronic
1068565587 10:58571136-58571158 CATGCCTTTCTAAAATCTTGCGG - Intronic
1069383434 10:67863256-67863278 TCTGCCTTTCTGAAGTAATGAGG + Intergenic
1070364570 10:75723827-75723849 GATGCCTTTGTGAAGTATGGGGG + Intronic
1070540686 10:77413250-77413272 CAGGGCTTCCTAAGGTATTGAGG - Intronic
1070696915 10:78570495-78570517 CAGGAATTGCTGAATTATTGAGG - Intergenic
1073798992 10:107020709-107020731 CAGACCTTTCTAAAGAATTTTGG + Intronic
1074692386 10:116018085-116018107 GAGGCCTGTCTGAAGGGTTGTGG - Intergenic
1075705510 10:124497859-124497881 CAGCCCTTTCTGGAGTTGTGAGG + Intronic
1076419508 10:130320416-130320438 TTGGCTTTTCTGAACTATTGAGG - Intergenic
1077081391 11:726095-726117 CAGGCCGGTCAGAAGTACTGGGG + Exonic
1077292941 11:1807890-1807912 CAGGTCTTTATGAAATATTGGGG + Intergenic
1085523657 11:77152327-77152349 CAGGCCTGTCAGCAGCATTGAGG - Intronic
1088146378 11:106685313-106685335 CAGGCCTATCACTAGTATTGAGG + Intronic
1089962820 11:122630776-122630798 CAGGCCTGTCTGCAGTTTTATGG + Intergenic
1091985353 12:4906668-4906690 TAGGCCTTTTTGCAGTCTTGAGG + Intergenic
1092595548 12:10000738-10000760 CAGGCTTTTCTGGAAGATTGGGG + Intronic
1092704855 12:11271276-11271298 CTGGCCCTTCTGAAGAGTTGGGG + Intergenic
1092712963 12:11357164-11357186 CTGGCCCTTCTGAAGAGTTGCGG + Intronic
1092716755 12:11397134-11397156 CTGGCCCTTCTGAAGAGTTGCGG + Intronic
1093242703 12:16697552-16697574 CAGGGCTGTCTGAAGTTTTGGGG + Intergenic
1093817549 12:23568232-23568254 CAGGACTGTCAGCAGTATTGAGG + Intronic
1096787620 12:54026600-54026622 CTGTCCTTTCTGGAGGATTGGGG + Intronic
1098131816 12:67359015-67359037 GAGGTCTTCCTGAAGTAGTGTGG - Intergenic
1103359705 12:120346415-120346437 CAGGACTTTCTGAAATGTGGGGG - Intronic
1104521569 12:129480557-129480579 CAGACCTTTCTGCAGTAATAGGG + Intronic
1104749150 12:131227611-131227633 CAGGCCATTCTGCACTTTTGAGG + Intergenic
1106539532 13:30677484-30677506 CAGGCCCTGCTGCAGTGTTGGGG - Intergenic
1107022431 13:35765617-35765639 CAGGCCCTTCTGAAATACTGTGG - Intergenic
1109079038 13:57874789-57874811 CAGGCCTGTGTGAAGCTTTGTGG + Intergenic
1109663536 13:65497705-65497727 CATTCCTTTCTGAAATTTTGAGG + Intergenic
1112102061 13:96200135-96200157 CAGACATTTTTGAAATATTGGGG - Intronic
1112195938 13:97226288-97226310 CAAGCGTTTCTGCTGTATTGAGG - Intronic
1113422088 13:110178862-110178884 CATGCTTTTCTGAAGCATGGGGG - Intronic
1113742552 13:112721624-112721646 CAGGCCCTTCTGCTGTCTTGTGG - Intronic
1113999420 14:16138421-16138443 GAGGGCTTTGTGGAGTATTGTGG - Intergenic
1114390956 14:22308172-22308194 CAGGCCTTACTGTAGCATGGGGG + Intergenic
1116929508 14:50675858-50675880 CAGGCCTTCCAGGAGGATTGAGG + Intergenic
1117274081 14:54174632-54174654 CTGGCCTTTCTGCAGAAATGTGG - Intergenic
1117326364 14:54672468-54672490 CAGCCTTTTCTGAAGTCTTACGG - Intronic
1118410879 14:65476284-65476306 CAGGCCTCCCTGAAGTTTAGGGG - Intronic
1119983222 14:79105651-79105673 AAGCCTTCTCTGAAGTATTGAGG + Intronic
1121235601 14:92389514-92389536 CAGCCCTTTCTGAGGAATGGAGG + Intronic
1122080905 14:99267169-99267191 TAGGCATTTCTGAAGTGCTGGGG - Intronic
1123226110 15:17032866-17032888 GAGGACTTTGTGGAGTATTGTGG + Intergenic
1130523399 15:84682395-84682417 CTGGCATATCTGAAGAATTGAGG - Intronic
1130850813 15:87791953-87791975 CAGGCATTCCTGAACTTTTGGGG - Intergenic
1131697198 15:94890638-94890660 CAAGCCTTGCTGAAGGTTTGAGG + Intergenic
1133606365 16:7392052-7392074 CTGGCCTGGCTTAAGTATTGTGG - Intronic
1135983255 16:27165137-27165159 CAGGCCTTTCTTAAGACTTAGGG + Intergenic
1136471847 16:30485989-30486011 CCTGCCCTTCTGAAGTAATGTGG - Intronic
1139404498 16:66707357-66707379 CACCCCTTTCTGAAGTCCTGGGG - Intergenic
1139584913 16:67895894-67895916 CTGGCTTTTCTGAAATCTTGAGG + Intronic
1144087453 17:11823554-11823576 CAGGGCTTTTTGAAAAATTGAGG - Intronic
1146659771 17:34657995-34658017 CAGGCCTTGCTGAATGAATGTGG - Intergenic
1147934705 17:44004982-44005004 CAGGCCTTCCTGAACCAGTGCGG + Exonic
1148195844 17:45712072-45712094 CAGGGTTTTCTGAAGTATTAAGG + Intergenic
1151103464 17:71583646-71583668 CAGGTCTTTGTGAAGTCATGTGG - Intergenic
1151445979 17:74164293-74164315 CAGGACTTGCTGATGGATTGGGG - Intergenic
1151952457 17:77362748-77362770 CAGGCCTTACTGAGTTAGTGTGG - Intronic
1151956466 17:77382674-77382696 CAGCCCTTTCTGAGGTTTTCTGG - Intronic
1153057065 18:956303-956325 CAGGCCTTTCAGGATTATTCAGG + Intergenic
1159852959 18:73548147-73548169 CAAGGTTTTATGAAGTATTGAGG - Intergenic
1160151538 18:76398617-76398639 GGGGCCTTTCTGAAGGAATGGGG + Intronic
1160426382 18:78781867-78781889 GAGGCCTATCCGAGGTATTGCGG + Intergenic
1160529979 18:79557068-79557090 GAGGCCTTGCTGGAGTCTTGGGG + Intergenic
1163263357 19:16204372-16204394 CAGGCCCTTCCGCAGTAGTGTGG - Intronic
1164608908 19:29618919-29618941 CACGCAGTTCTGAAGTCTTGGGG + Intergenic
929652739 2:43698047-43698069 CAGGCCTCTCTAAAATATTTGGG - Intronic
930165281 2:48198077-48198099 CAGACCTTACTGAAGACTTGGGG - Intergenic
933437387 2:82264876-82264898 GAGCCCTTTGTGAAGTTTTGTGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935101975 2:100004937-100004959 CTGGCCTTTTTGAAATATTCAGG + Intronic
938737570 2:134200307-134200329 CATCCCTGTCTGAAGTATTCAGG - Intronic
939795758 2:146642318-146642340 AAGGCCTTTCTGAGCTGTTGGGG - Intergenic
948111976 2:235463681-235463703 CAGGCCATTCTGATGCACTGGGG + Intergenic
948749128 2:240119473-240119495 CAGTCCTCTCTGAGGTACTGGGG + Intergenic
1169376341 20:5069453-5069475 CAGGCCTTCAGGAAGTGTTGTGG - Intronic
1171735178 20:28772293-28772315 GAGGGCTTTGTGGAGTATTGTGG - Intergenic
1176323668 21:5363366-5363388 GAGGTCTTTGTGGAGTATTGTGG + Intergenic
1178139352 21:29664750-29664772 CTTGCATTTATGAAGTATTGAGG + Intronic
1180399965 22:12406462-12406484 GAGGACTTTGTGGAGTATTGTGG + Intergenic
1180659874 22:17457358-17457380 TAGGCCTTTCTGAACTAATAGGG + Intronic
1183165929 22:36147468-36147490 CAAGCCCTTCTGAAGGATTCCGG + Intronic
1184366005 22:44051806-44051828 GAGGCCTGTCTGAAGTAGGGTGG + Intronic
1185360273 22:50402499-50402521 CAGGCCTCTCTGGAGTTCTGTGG + Intronic
949419140 3:3846530-3846552 CAGCCCTTGCTGCAGTAATGGGG + Exonic
952331709 3:32369434-32369456 CAGGCCCTTCTTAATTAATGGGG - Intronic
953888449 3:46733318-46733340 CAGGACATACTGAGGTATTGAGG - Intronic
957174272 3:76785417-76785439 CAGGTCTTCCTAAAGTATAGTGG + Intronic
963370615 3:144395103-144395125 AAGGCCATTCTGAGGTACTGGGG + Intergenic
966777449 3:183555468-183555490 CAGGCCATTCTGAAGAATTAAGG + Exonic
967479445 3:189957027-189957049 CAGTCCTTTCTGGAGTACTGTGG + Exonic
970929946 4:21498019-21498041 CAGGGCTTTCTGAAGGAGTATGG - Intronic
971922880 4:32966117-32966139 CATTCTTTTCTAAAGTATTGTGG + Intergenic
972072498 4:35038727-35038749 CAGGCATTCCTGCAGTCTTGGGG + Intergenic
976266274 4:83188335-83188357 AAGCTTTTTCTGAAGTATTGTGG + Intergenic
978902200 4:113964803-113964825 CTAGCCTTTCTGAAATATTAGGG + Intronic
979290071 4:118969667-118969689 CAGGACTTTCTAAAGTCTTCTGG + Intronic
979829224 4:125280107-125280129 CAGGCCTTTCAGTGGTTTTGTGG - Intergenic
983702422 4:170614482-170614504 CAGGGCTTCCTGAAGCTTTGTGG - Intergenic
986672388 5:10153992-10154014 CAGGACTGTCTGAAGGATTCAGG - Intergenic
988306362 5:29499101-29499123 CAGGCCTTCAGGAAGTACTGCGG + Intergenic
988998775 5:36739995-36740017 CTGGCCTTTATGATGGATTGAGG - Intergenic
991648069 5:68821308-68821330 AGGGCCTTTCTGAACAATTGTGG - Intergenic
993745849 5:91596072-91596094 CAGGCCTTTATCAAGTGTTAGGG - Intergenic
994545661 5:101163346-101163368 CAGGCCTTGCAGAACTGTTGTGG - Intergenic
998324657 5:141269199-141269221 CTGTCCTCTCTGAAGTTTTGGGG + Intergenic
1000642691 5:163721397-163721419 CTTGACTTTCTGAATTATTGTGG - Intergenic
1006436114 6:34026963-34026985 CAGGCCTTTCTGCCAAATTGGGG - Intronic
1007969751 6:46038731-46038753 CATGCCTTTCTGAAACATTATGG + Intronic
1008704335 6:54139385-54139407 CAGGCCTGTCGGAAATATTTAGG + Intronic
1010611325 6:77957277-77957299 CACTCCTTTCTAAAGTAATGAGG - Intergenic
1012476284 6:99617958-99617980 CAGGTCTGTCTGAGGTATTTAGG - Intergenic
1012641715 6:101625660-101625682 CATGCCTTTCTTAATTACTGTGG + Intronic
1014827091 6:126058922-126058944 TAGGCCTCTCTGAGGTATAGAGG - Intergenic
1017746925 6:157455517-157455539 CAGGTCTTTCTTAAGTCTGGAGG + Intronic
1020485603 7:8716239-8716261 GAGGACTTTCTGAAGTTTTGAGG - Intronic
1024294913 7:47834032-47834054 CAGGGCTTTCTGAATTCTTCTGG + Intronic
1028835496 7:95370120-95370142 CAGGCCGTTCTGGAGATTTGGGG + Intronic
1029864195 7:103608153-103608175 CAGGTTTTTCTCAAGCATTGGGG - Intronic
1033984023 7:147200489-147200511 CAGTCCTTTTTAAAGGATTGTGG - Intronic
1035624247 8:1059629-1059651 CAGGCATTTGTGAAGTGGTGGGG - Intergenic
1035648925 8:1249397-1249419 CAGGTGTTTCTGAACTACTGAGG + Intergenic
1040923342 8:52649245-52649267 CAGGCCTCTTTAAAGTATTCAGG - Intronic
1041861692 8:62521168-62521190 CAGGCCTTCCTGAAGGATAGCGG + Intronic
1044258435 8:90092543-90092565 TAGGCTTGACTGAAGTATTGGGG + Intronic
1044369769 8:91395682-91395704 CATCCATTTCTGAAGTATTCAGG + Intronic
1044904841 8:96989956-96989978 CAGGGCTCTCTGTAGTATTCTGG + Intronic
1045069288 8:98484174-98484196 CTGGTCTTTCTGAAAAATTGTGG - Intronic
1046718698 8:117595168-117595190 CTGGACTTTGAGAAGTATTGAGG + Intergenic
1048260536 8:132941363-132941385 AAAGCGTTTCTGAAGTGTTGTGG - Exonic
1048431913 8:134378489-134378511 CAGCCCATTCTAAGGTATTGCGG + Intergenic
1050681859 9:8120527-8120549 CAGCCATTGCTGAAGAATTGAGG + Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1203381184 Un_KI270435v1:45665-45687 GAGGACTTTGTGGAGTATTGTGG + Intergenic
1189854679 X:45212061-45212083 CAGTTGTTTCTGAAGTATTCAGG + Intergenic
1192081560 X:68052794-68052816 CAGACCATTCTGAAGCAATGGGG - Intronic
1192606833 X:72527321-72527343 CAGGCCTTTCTGAAGTATTGAGG - Intronic
1197378283 X:125709320-125709342 CAGGCATTTCTGCACTCTTGAGG + Intergenic
1199082861 X:143595667-143595689 TGGGCCTTTCTGAAGTTTTGGGG - Intergenic
1200006835 X:153091317-153091339 CGGGCCTTTCTGAAAGATTGAGG + Intergenic
1200359758 X:155592400-155592422 CAGGCTTTTCCCAAGTTTTGGGG - Intronic
1201494260 Y:14576207-14576229 CAGGCCTTCTTGAAGTGTGGTGG + Intronic