ID: 1192607134

View in Genome Browser
Species Human (GRCh38)
Location X:72529968-72529990
Sequence CAGTCTTGGCAGAGGGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 909
Summary {0: 1, 1: 0, 2: 1, 3: 61, 4: 846}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192607134_1192607138 -9 Left 1192607134 X:72529968-72529990 CCTTTGTCCCTCTGCCAAGACTG 0: 1
1: 0
2: 1
3: 61
4: 846
Right 1192607138 X:72529982-72530004 CCAAGACTGTAAGTTTTCTGAGG 0: 2
1: 68
2: 1297
3: 7652
4: 8783

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192607134 Original CRISPR CAGTCTTGGCAGAGGGACAA AGG (reversed) Intronic
900303371 1:1989187-1989209 CCGTCTTTGCAGACGGACAGCGG + Intronic
900501658 1:3008639-3008661 CAATCATGGCAGAGGGCAAAGGG - Intergenic
900553520 1:3268663-3268685 CTGCCTTAGCAGAGGCACAAGGG + Intronic
900725257 1:4212380-4212402 CAATCTTGGCAGAAGGTGAAAGG + Intergenic
900810622 1:4798896-4798918 CAATCATGGCAGAAGGTCAAAGG - Intergenic
900945362 1:5828248-5828270 AAGTCCAGGCAGAGCGACAAGGG + Intergenic
901117041 1:6855406-6855428 CAATCATGGCAGAAGGAGAAGGG + Intronic
901163221 1:7196249-7196271 CAGTCATGGCAGAAGGCAAAGGG - Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902176811 1:14656630-14656652 CAGTCATGGCAGAAGGCAAAGGG + Intronic
902987826 1:20166209-20166231 CAGACTTTGCAGAGGGAGAGTGG - Intronic
904313071 1:29641847-29641869 CAGTTTCAGCAGAGGGACCAGGG + Intergenic
904959161 1:34317312-34317334 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
905017467 1:34787444-34787466 CAGTCTTGCCATCGGTACAATGG + Intronic
905267198 1:36762822-36762844 CATTCTAGGCAGAGGGAACAGGG + Intergenic
905930012 1:41780280-41780302 CAGCCTTGGCAGAGTGGCCAAGG - Intronic
906534103 1:46542230-46542252 CAGCTTTGGCAGAAGGACAAAGG - Intergenic
906661530 1:47586305-47586327 CAGAGTTGGAAGAGGGGCAATGG - Intergenic
907017419 1:51030645-51030667 CAGTCTTGTCAGAGATAAAATGG + Intergenic
907418809 1:54332760-54332782 CAGCTTTGGCTGTGGGACAAGGG - Intronic
907593799 1:55701267-55701289 CAGCCTTGGCAAATAGACAAAGG - Intergenic
907749382 1:57247386-57247408 CAGTCATGGCAGAAGGAGAAGGG - Intronic
907959789 1:59268158-59268180 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
908047819 1:60190525-60190547 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
908646905 1:66288152-66288174 CAGTCATGGCAGAAGGTGAAGGG + Intronic
908931350 1:69319481-69319503 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
908973594 1:69868475-69868497 CGGTGTTAGCAGAGGTACAAAGG + Intronic
909115933 1:71536453-71536475 CACTCATGGCAGAGGGTGAAAGG - Intronic
909457960 1:75871097-75871119 CAATCATGGCAGAAGGAGAAGGG + Intronic
909664968 1:78122486-78122508 CAGTCATGGCAGAAGGTGAAGGG + Intronic
910070901 1:83212592-83212614 CAGGCCTGGGAGAGGGAAAACGG - Intergenic
910291000 1:85600332-85600354 CAATCATGGCAGAAGGGCAAAGG - Intergenic
910556592 1:88541409-88541431 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
910642572 1:89479963-89479985 CAATCATGGCAGAAGGAGAAAGG + Intergenic
910860283 1:91736783-91736805 CTGTGCTGGCAGTGGGACAAAGG - Intronic
911237250 1:95424822-95424844 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
911602556 1:99862633-99862655 CAGTCATGGCAGAAGGCAAAGGG + Intronic
911644233 1:100321251-100321273 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
912619496 1:111140506-111140528 CAGTCTCCACAGAGGGGCAAGGG - Intronic
912936372 1:114006969-114006991 CAATCATGGCAGAAGGAGAAGGG + Intergenic
912942814 1:114060000-114060022 CAATCATGGCAGAAGGCCAACGG - Intergenic
912970883 1:114281891-114281913 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
913075788 1:115339179-115339201 CAGCCCTGGCAGAGGGGCAGGGG - Intergenic
914409199 1:147408608-147408630 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
914421592 1:147533095-147533117 CAGTCTAGGGGGAGGGAGAAAGG + Intergenic
915760963 1:158312361-158312383 CAGTCATGGCAGAAGGTAAAAGG - Intergenic
915870973 1:159559269-159559291 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
915877800 1:159630847-159630869 CAATCATGGCAGAAGGGCAAAGG + Intergenic
916440037 1:164815604-164815626 CAGTCATGGCAGAAGGTGAAGGG + Intronic
917393683 1:174568115-174568137 CAGTCATGGCAGAAGGTGAAGGG + Intronic
917573787 1:176297829-176297851 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
918711154 1:187732104-187732126 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
918859135 1:189798976-189798998 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
918965649 1:191344207-191344229 CAGCCTTGGCTGGGGGAAAAAGG - Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920336241 1:205247280-205247302 AGGTCTTGGCAGGGAGACAAGGG + Intronic
920937487 1:210449159-210449181 CAGACATGGCAGAGGGACCCGGG - Intronic
921715892 1:218416926-218416948 CAGTCATGGCAGAAGGTGAAAGG - Intronic
921931932 1:220761960-220761982 CAGCCTAGGCAGAGGTACCAGGG + Intronic
922096262 1:222445560-222445582 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
922257138 1:223902204-223902226 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
923179571 1:231503162-231503184 CAGTCTTGGCAGAAGGTGAAAGG - Intergenic
923424459 1:233854974-233854996 CAGTCATGGCAGAAGGCGAAGGG - Intergenic
923478377 1:234358824-234358846 CAGTCGTGGCAGAAGGCAAAAGG + Intergenic
924145365 1:241069007-241069029 CAGTCATGGCAGAAGGCAAAAGG - Intronic
924427676 1:243968041-243968063 CAGTAATGCCAGAGGGACCAGGG + Intergenic
924781634 1:247154371-247154393 CAGTCCTGGCAGAAGGTGAAGGG - Intronic
924781971 1:247158344-247158366 CAGTCATGGCAGAAGGGGAAGGG - Intronic
1062773582 10:125630-125652 CAATCCTGGCAGAAGGACAAAGG - Intergenic
1062971630 10:1653262-1653284 CAGTCATGGCAGAAGGACTTGGG + Intronic
1063037532 10:2301838-2301860 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1063538505 10:6909132-6909154 CAATCGTGGCAGAAGGCCAAGGG + Intergenic
1063817321 10:9790565-9790587 TAATCTTGGCTGAGGGAGAAGGG - Intergenic
1064206145 10:13325534-13325556 CAGTCGTGGCAGATGGTGAAGGG - Intronic
1064583278 10:16815316-16815338 ATGTCTTGGCAGAAGGAAAAGGG - Intronic
1064678638 10:17786993-17787015 CAATCATGGCAGAGGGTGAAAGG - Intronic
1064968616 10:21040441-21040463 CAGTCATGGCAGAAGGTGAAGGG + Intronic
1065009954 10:21411998-21412020 CAATCATGGCAGAGGGCGAAAGG + Intergenic
1065515413 10:26519391-26519413 CAATCATGGCAGAGGGTAAAGGG + Intronic
1065534368 10:26702546-26702568 CAATCATGGCAGAAGGAAAAGGG - Intronic
1065689534 10:28319117-28319139 CAATCATGGCAGAGGGTGAAGGG + Intronic
1065738466 10:28775002-28775024 CAGTCGTGGCAGACGGCAAAGGG - Intergenic
1065993960 10:31039143-31039165 CAGTCATGGCAGAAAGAGAAGGG + Intergenic
1066006919 10:31154175-31154197 CACTCATGGCAGAGGGTGAAGGG + Intergenic
1066150142 10:32607170-32607192 CAATCATGGCAGAGGGCAAAGGG - Intronic
1066533739 10:36367569-36367591 CAGGCTTGGAAGAGGGCCAACGG + Intergenic
1067033455 10:42896467-42896489 CACTCATGGCAGAAGGGCAAGGG + Intergenic
1067050595 10:43016321-43016343 TAGTCATGGCAGAGGGCAAAAGG - Intergenic
1067249351 10:44574181-44574203 CAGACTTGGGAGAGGCAGAAGGG + Intergenic
1067271874 10:44798734-44798756 CAGTCTTGCCAGAGAGTAAAGGG + Intergenic
1067321272 10:45223426-45223448 ACGTCTTGGCAGAAGGAAAAGGG - Intergenic
1067452828 10:46392803-46392825 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1067584404 10:47466952-47466974 CAGTCATGGCAGAAGGTGAAGGG - Intronic
1068147869 10:53093991-53094013 CAGTCATGGCAGAAGGTAAAGGG - Intergenic
1068283123 10:54902503-54902525 CAGTCATGGCAGAATGGCAAGGG - Intronic
1068507980 10:57927300-57927322 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1069417151 10:68210613-68210635 CAGTCTCAGCTGAGGGAGAAAGG + Exonic
1069952764 10:72031023-72031045 AACTCTGGGCAGGGGGACAATGG + Intergenic
1069968793 10:72146533-72146555 CATTCTTTTGAGAGGGACAAGGG + Intronic
1070476175 10:76831232-76831254 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
1071541957 10:86493457-86493479 CAATCTAGGCAGAGGGATATGGG + Intronic
1071700102 10:87922235-87922257 CAATCATGGCAGAAGGCCAAGGG - Intronic
1072049149 10:91686490-91686512 CAATCATGGCAGAAGGAGAAAGG + Intergenic
1072201067 10:93159231-93159253 CAATCATGGCAGAAGGCCAAAGG - Intergenic
1072362874 10:94677043-94677065 CAATCATGGCAGAGGGCAAAAGG - Intergenic
1072382504 10:94889978-94890000 CAATCATGGCAGAGGGCAAAAGG - Intergenic
1072405172 10:95144885-95144907 CAGTCATGGCAGAAGGCAAAAGG + Intergenic
1073887457 10:108056547-108056569 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
1074156730 10:110806385-110806407 CAGTCGTGGCAGAAGGCAAAGGG + Intronic
1074689021 10:115987282-115987304 CAATCATGGCAGAAGGAGAAGGG + Intergenic
1075043679 10:119128732-119128754 CAATCATGGCAGAGGGTGAAGGG + Intronic
1075208884 10:120473814-120473836 CAGTCATAGCAGAAGGGCAAAGG - Intronic
1075245138 10:120814890-120814912 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1075864054 10:125702664-125702686 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1075988484 10:126810421-126810443 CAATCATGGCAGAGGGTGAAAGG - Intergenic
1076191837 10:128488674-128488696 CAGTCTTGGGAGATAAACAAAGG + Intergenic
1076239182 10:128890802-128890824 CAATCATGGCAGAGGGCAAAGGG - Intergenic
1076393309 10:130120131-130120153 CAATCATGGCAGAAGGCCAAGGG + Intergenic
1076747675 10:132522617-132522639 CAGACTGGGCAGAGGCTCAAGGG - Intergenic
1077730596 11:4725121-4725143 CAGTCATGGCAGAAGGCAAAAGG - Intronic
1077938538 11:6815442-6815464 CAGTCATGGCCGAAGGAAAAGGG - Intergenic
1078379041 11:10823054-10823076 CAGTGTTGGGAGAGGGAAAGAGG + Intronic
1078721378 11:13887018-13887040 CAGTCATAGCAGAAGGGCAAAGG - Intergenic
1079662820 11:23062728-23062750 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1079688999 11:23399383-23399405 CAGTGGTGGCAGAGTGAGAATGG + Intergenic
1079707484 11:23638623-23638645 CAATCATGGCAGAAGGGCAAAGG + Intergenic
1079796748 11:24813432-24813454 CAGTCATGGCAGAAGGCAAAGGG + Intronic
1080205490 11:29724489-29724511 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1080591931 11:33732083-33732105 CAATCATGGCAGAGGGTGAAAGG - Intronic
1080990669 11:37530436-37530458 CAGTCATGGCAGAAGGGCAAAGG + Intergenic
1081033990 11:38118330-38118352 CAGTCATGGCAGAATGTCAATGG - Intergenic
1081440456 11:43075469-43075491 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
1081687972 11:45055985-45056007 CAGTCATGGCAGAAGAAGAAAGG + Intergenic
1081977244 11:47243392-47243414 CAGGCCTGGCAGAGGGTGAAAGG - Intronic
1082267881 11:50139113-50139135 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
1082288211 11:50339407-50339429 CAGTCGTGGCAGAAGGTGAAGGG + Intergenic
1082708650 11:56525752-56525774 CTGTCGTGGCAGAAGGAGAAAGG + Intergenic
1082827154 11:57588278-57588300 CAGTCATGGCAGAAGGGCAAAGG - Intergenic
1083256826 11:61501673-61501695 CAGTCATGGCAGAAGGTAAAAGG + Intergenic
1083299476 11:61732801-61732823 CAGCCTGGCCAGAGGGAGAAGGG + Intronic
1083554830 11:63617835-63617857 CAGTCATGGCAGAAGGAAAAAGG - Intergenic
1083962107 11:66020386-66020408 CAGGCTGGGGAGAGGGACAGGGG + Exonic
1084166323 11:67376333-67376355 CAGGCATGGCAGAGGGGCACTGG - Intronic
1084469082 11:69344770-69344792 CAGTCATGGCAGAAGGTGAAGGG + Intronic
1084895417 11:72263781-72263803 CAATCATGGCAGAAGGTCAAGGG - Intergenic
1085110915 11:73887010-73887032 CACTCATGGCAGAAGGAGAAGGG - Intronic
1085284885 11:75353018-75353040 CAGATTTGGCAGAGGGGCAGGGG + Intergenic
1085295235 11:75427758-75427780 CAGTATGGGCAAAGGCACAAGGG - Intronic
1085532511 11:77200349-77200371 CACTCATGGCAGAAGGAGAAGGG + Intronic
1085740743 11:79076399-79076421 CAGTCATGGCAGAAGGTGAAAGG + Intronic
1085987006 11:81799939-81799961 CAGTCTTGGCAGAAGGTGAAGGG - Intergenic
1086068169 11:82768645-82768667 CTGTCTTGGCAGTGCAACAATGG + Intergenic
1086314357 11:85574737-85574759 TAGTCATGGCAGAGGGAAAGAGG - Intronic
1086774406 11:90812302-90812324 CAGTCATGGCAGAAGGGGAAGGG + Intergenic
1086871010 11:92036573-92036595 CACTCTGGGCTGAAGGACAATGG - Intergenic
1086954994 11:92926401-92926423 CAATCATGGCAGAGGGCTAAGGG - Intergenic
1087083882 11:94197440-94197462 CAATCATGGCAGAGGGCAAAAGG - Intergenic
1087511715 11:99102987-99103009 CAGTCATGGCAGAAGGCAAAAGG + Intronic
1087537069 11:99462606-99462628 CAGTCTTTGCTGAGTGACAAAGG - Intronic
1087630060 11:100639399-100639421 CCGCCTTGGCAGTGGGAAAATGG - Intergenic
1087725603 11:101712758-101712780 CAGTCATGGCAGAAGGCAAAGGG + Intronic
1087773735 11:102238985-102239007 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1087829919 11:102808279-102808301 CAGCGTCGGCAGAGGGACAGGGG - Intergenic
1088644356 11:111904840-111904862 CAGTCATGGCAGAGGGTGAAAGG - Intergenic
1089187395 11:116628664-116628686 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1089598249 11:119596261-119596283 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1089667558 11:120030065-120030087 CAGTCATGGCAGAAGGAGAAGGG + Intergenic
1090040785 11:123289530-123289552 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1090106915 11:123863148-123863170 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1090523219 11:127501069-127501091 CAGTCATGGTGGAGGGTCAAGGG - Intergenic
1090728865 11:129552428-129552450 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1090915277 11:131157448-131157470 CAGTCATGGCAGAAGGGGAAGGG - Intergenic
1091324170 11:134671717-134671739 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
1091589831 12:1836495-1836517 CAGTCCTGGCAGGTGGACAGAGG + Exonic
1091826817 12:3519120-3519142 CCGTCTTTGCAGACGGACAGAGG + Intronic
1092315742 12:7411594-7411616 CAATCATGGCAGAAGGCCAAGGG - Intronic
1092698287 12:11199033-11199055 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1092722159 12:11451963-11451985 CAGTCATGGCAGAAGGTGAAGGG - Intronic
1092739838 12:11616847-11616869 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1093510638 12:19923063-19923085 CACTCATGGCAGAAGGCCAAGGG - Intergenic
1093522337 12:20065929-20065951 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1093681346 12:22007241-22007263 CAGTCATGGCAGAAGGTGAAAGG - Intergenic
1093743117 12:22710822-22710844 CCTTCCTGGCAGAGGCACAAAGG - Intergenic
1094002081 12:25706377-25706399 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1094288441 12:28819103-28819125 CTGTCTTTGCAGATGGACAGAGG + Intergenic
1095039390 12:37424481-37424503 GAGTCTTGGCAGTGGGGTAAAGG + Intergenic
1095262796 12:40116715-40116737 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1095301849 12:40593527-40593549 CAGTGATGGCAGAGGCACAAGGG + Intergenic
1095320500 12:40820116-40820138 CAGTCATGGCAGAAGGCAAAGGG + Intronic
1095516748 12:43014876-43014898 CAGTCATGGCAGAAGGCAAAAGG - Intergenic
1095838693 12:46668693-46668715 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1095931646 12:47632195-47632217 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1096180522 12:49548232-49548254 CACACTTGGGAGAGGGACAAAGG - Intronic
1097343783 12:58468560-58468582 CAGTCATGGCAGAAGTGCAACGG + Intergenic
1097499076 12:60379083-60379105 CAGTCATGGCAGAAGGTGAAAGG - Intergenic
1097541246 12:60946307-60946329 CATTCTTTGGAGAGGGAGAAGGG + Intergenic
1097632918 12:62086005-62086027 CAATCATGGCAGAAGGAGAAGGG - Intronic
1097956057 12:65486484-65486506 CAGTCATGGCAGAAGGCAAAAGG - Intronic
1098260532 12:68665488-68665510 CAGTCTTGGGATGGGGAGAAGGG + Exonic
1098437122 12:70479720-70479742 CAATCATGGCAGACGGGCAAAGG - Intergenic
1098536551 12:71599755-71599777 CAATCATGGCAGATGGAGAAGGG - Intergenic
1098744813 12:74222600-74222622 CAATCATGGCAGAGGGCAAAGGG + Intergenic
1098836239 12:75427845-75427867 CAGTCATGACAGAGGGTGAAGGG - Intronic
1099096456 12:78380047-78380069 CAGTCATGGCAGAAGGCAAAAGG + Intergenic
1099438325 12:82669619-82669641 CAGTCGGGGCTGAGGGGCAATGG + Intergenic
1099526905 12:83727378-83727400 CAGTCATGGCAGAAGGTGAAAGG - Intergenic
1099572061 12:84334984-84335006 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1100639796 12:96471490-96471512 AAGGCATGCCAGAGGGACAAAGG + Intergenic
1100743128 12:97617159-97617181 CAGTCTTGGCACAAGCACTAAGG - Intergenic
1101420002 12:104543109-104543131 CAGTCATGGCAGAAGGTGAAGGG + Intronic
1101973576 12:109335255-109335277 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1102449195 12:113027961-113027983 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1102649838 12:114432306-114432328 CAGTCGTGGCAGATAGACAAAGG + Intergenic
1103031017 12:117612939-117612961 CAATCATGGCAGAAGGAAAAGGG - Intronic
1103050958 12:117779060-117779082 CTGTCTTTGCAGAGGGAAATTGG - Intronic
1103204304 12:119116385-119116407 CAGTCTTACCAGGGAGACAAAGG + Intronic
1103466945 12:121149431-121149453 CAATCATGGCAGAGGGCGAAAGG + Intronic
1103844531 12:123892267-123892289 CAGTCATGGCAGAAGGTGAAGGG + Intronic
1103970711 12:124669407-124669429 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1104110177 12:125697373-125697395 CAATCATGGCAGAAGGGCAAAGG - Intergenic
1104486851 12:129158867-129158889 CAGTCATGGCAGAAGGTGAAGGG + Intronic
1104884510 12:132098657-132098679 CAATCTTGGCAGAAGGCAAAGGG + Intronic
1105054124 12:133081255-133081277 CAGACCTGGCAGAGAGAGAAAGG - Exonic
1106588166 13:31075025-31075047 CACTCTTGGCAGAAGGCAAAGGG - Intergenic
1106599714 13:31177148-31177170 CAGTCATGGCAGAAGGGGAAGGG - Intergenic
1106733474 13:32566377-32566399 CAATCCTGGCAGAAGGAGAAGGG + Intergenic
1106822412 13:33479861-33479883 CAATCATGGCAGAAGGAGAAGGG - Intergenic
1107050605 13:36044173-36044195 CACTCTTGGCAGAAGGTGAAGGG - Intronic
1107435667 13:40378473-40378495 CAATCATGGCAGAGGCAGAAGGG - Intergenic
1107640119 13:42433495-42433517 CAGTCATGGCAGAAGGCAAAAGG - Intergenic
1107666500 13:42696198-42696220 CAGTGATTGCAGAGGTACAAGGG - Intergenic
1108274075 13:48790332-48790354 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1108792887 13:53994451-53994473 CAATCATGGCAGAGGGCAAAGGG + Intergenic
1109098118 13:58143979-58144001 CAATCATGGCAGAAGGTCAAAGG - Intergenic
1109122742 13:58478495-58478517 CAGTCTTGGTAGAAGGCAAAGGG - Intergenic
1109150084 13:58836338-58836360 CAGTCATGGCAGAAGGCAAAAGG + Intergenic
1109341363 13:61064672-61064694 CAGTTATGGCAGAAGGAGAAGGG + Intergenic
1109342384 13:61077285-61077307 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1109717532 13:66235377-66235399 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1109920738 13:69054738-69054760 CAGTCATGGCAGGGGGTAAAGGG + Intergenic
1109955325 13:69558051-69558073 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
1109958537 13:69601816-69601838 CAGTCTTGGCAGAAGGTGAAAGG + Intergenic
1110223518 13:73096530-73096552 CAGGGTCGGCAAAGGGACAAGGG + Intergenic
1110545939 13:76755505-76755527 GGGTCATGGCAGAGGGAGAAGGG - Intergenic
1110987662 13:81991909-81991931 CAGTCTTGGCAGAAAGCAAAGGG + Intergenic
1110989783 13:82025619-82025641 CAATCATGGCAGAAGGAAAAGGG + Intergenic
1111668416 13:91298918-91298940 CAGTCATGGCAGAAGGTGAAAGG - Intergenic
1112359751 13:98706679-98706701 CAGTCATGGCAGAAGGTGAAAGG - Intronic
1112418747 13:99228192-99228214 CAGTCCTGTCAGAGTCACAAAGG + Intronic
1112499794 13:99933966-99933988 CAATCATGGCAGAAGGTCAAGGG + Intergenic
1112635157 13:101208812-101208834 CAGTCATGGCAGAAGGTGAAAGG - Intronic
1112792031 13:103013894-103013916 CAGGCCTTGCTGAGGGACAAGGG - Intergenic
1113090231 13:106610280-106610302 CAGTCATGGCAGAAGGCCAATGG - Intergenic
1113960861 13:114125381-114125403 CAGTCATGGCAGAAGGTGAAGGG + Intronic
1114197395 14:20490967-20490989 CAATCATGGCAGAGGGTGAAAGG + Intergenic
1114601706 14:23960906-23960928 CAATCATGGCAGAAGGAAAAAGG + Intronic
1114605876 14:23996027-23996049 CAATCATGGCAGAAGGAAAAAGG + Intronic
1115727652 14:36234838-36234860 CAGTCTTAGAAGAGGGAGAGAGG - Intergenic
1115957570 14:38798307-38798329 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
1115990258 14:39143255-39143277 CAATCATGGCAGAGGGCAAAAGG + Intergenic
1116071091 14:40046870-40046892 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1116145413 14:41061630-41061652 CAGTCATGGCAGAAGGCAAACGG - Intergenic
1116381372 14:44273223-44273245 CAGTATTAACAGAGGGACTAAGG - Intergenic
1116770714 14:49123955-49123977 CACTCCAGGCTGAGGGACAAGGG + Intergenic
1116975336 14:51109720-51109742 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1117598430 14:57347761-57347783 TAGCTTTGGCAGAGGGGCAAAGG + Intergenic
1118873594 14:69764326-69764348 CAGTCGTGGCAGAAGGCAAATGG - Intronic
1118883960 14:69851411-69851433 CAGTCTTGGCAGAGAGGAATGGG - Intergenic
1119017051 14:71069044-71069066 CAGTCATGGCAGAAGGTGAAAGG + Intronic
1119103349 14:71900858-71900880 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1119767078 14:77196882-77196904 CAGGCTGGGCTGAGGGGCAAGGG - Intronic
1120073003 14:80124157-80124179 CAGACATGGCAGAAGGCCAAAGG - Intergenic
1120377449 14:83728616-83728638 CAATCGTGGCAGAAGGAAAAGGG + Intergenic
1120807584 14:88769352-88769374 CAGTCATGGCAGAAGGCAAAGGG - Intronic
1120849002 14:89151847-89151869 CAATCATGGCAGAAGGGCAAAGG + Intronic
1120902529 14:89588209-89588231 CAGTCATGGCAGAAGGCAAAGGG - Intronic
1121545257 14:94758482-94758504 CAGTTTGGGCAGGGGTACAAGGG - Intergenic
1122034061 14:98934842-98934864 CAATCATGGCAGAAGGTCAAAGG - Intergenic
1122748842 14:103918217-103918239 CAGTCGTTGCTGAGAGACAAGGG - Intronic
1122765342 14:104065646-104065668 CAGTCATGGTAGAAGGGCAAAGG + Intergenic
1122855780 14:104559486-104559508 CAGACCAGGAAGAGGGACAAAGG - Intronic
1122860531 14:104580454-104580476 CAGCCTGGGCAGTGGGAGAAGGG + Intronic
1123827215 15:24094058-24094080 CAATCATGGCAGAAGGAGAAGGG + Intergenic
1123851709 15:24363540-24363562 CAATCATGGCAGAAGGAGAAGGG + Intergenic
1123883414 15:24697116-24697138 CCGTCTTTGCAGACGGACAGAGG - Intergenic
1124158306 15:27247719-27247741 CAATCATGGCAGAGGGTGAAAGG + Intronic
1124393688 15:29282324-29282346 CAGTCATGGCAGAAGGCAAAGGG - Intronic
1124661178 15:31552161-31552183 CAGTCCTGGCAGAAGGGGAAGGG - Intronic
1124851654 15:33345379-33345401 CACTCTAGCCAGAGTGACAAAGG - Intronic
1124864753 15:33478173-33478195 CAGTCTTCTCAGAAGGACATAGG + Intronic
1125452543 15:39824178-39824200 CAGTCATGGCAGAAGGCGAAGGG - Intronic
1126022614 15:44417505-44417527 CAGTCATGGCAGAAGGCAAAAGG + Intergenic
1127410705 15:58703790-58703812 CAGTCATAGCAGAAGGAGAAGGG - Intronic
1128874930 15:71194090-71194112 CAATCATGGCAGAAGGATAAAGG - Intronic
1130546682 15:84861985-84862007 GAGACTTGGCAGAAGGACACAGG - Intronic
1130615941 15:85407845-85407867 GTGGCTTGGCAGAGGGAGAAGGG + Intronic
1130704067 15:86215433-86215455 TAGAGTTGGCAGTGGGACAAGGG - Intronic
1130706938 15:86242100-86242122 CAATCATGGCAGAAGAACAAGGG - Intronic
1131342679 15:91617343-91617365 CAGTCATGGCAGAAGGTAAAGGG + Intergenic
1131665202 15:94564215-94564237 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1131770164 15:95728581-95728603 CAATCATGGCAGAAGGTCAAGGG - Intergenic
1131795903 15:96016514-96016536 CAGTCATGGCGGAAGGAGAAAGG - Intergenic
1133402022 16:5495129-5495151 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1133434321 16:5766211-5766233 CAATCATGGCAGAAGGAGAAGGG + Intergenic
1134603499 16:15551773-15551795 CAGTCATGGCAGACGGCGAAGGG + Intronic
1135502238 16:23006529-23006551 CACTCGTGGCAGAAGGGCAAAGG + Intergenic
1135577515 16:23597204-23597226 CAGTCTTTGCAGACAGACAGGGG - Intergenic
1135784920 16:25340172-25340194 CAGTCATGGCAGAAGAGCAAGGG + Intergenic
1135899068 16:26439594-26439616 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1135907051 16:26521814-26521836 CAGTCATGGCAGAAGGTGAACGG - Intergenic
1135990827 16:27217788-27217810 CAGGGTTGCCAGAGGGACACAGG - Intronic
1136156787 16:28388473-28388495 CAGTCATGGCAGAGGGGAATGGG - Intronic
1136206299 16:28726808-28726830 CAGTCATGGCAGAGGGGAATGGG + Intronic
1137533022 16:49295401-49295423 CAGCCTTGGCAAAGTCACAAGGG - Intergenic
1137810833 16:51350991-51351013 CAATCCTGGCAGAAGGGCAAAGG + Intergenic
1138548302 16:57732870-57732892 CAATCATGGCAGAAGGCCAAAGG + Intergenic
1138607161 16:58096870-58096892 CAGCCTTGGCAGCGGGGCAGGGG - Intergenic
1139124228 16:64058488-64058510 CAATCGTGGCAGAAGGTCAAGGG + Intergenic
1139336850 16:66238547-66238569 CAGTCATGGCAGATGGCGAAGGG + Intergenic
1139434817 16:66930305-66930327 CAATCTGGGCATAGGGCCAAGGG + Intergenic
1140462935 16:75155973-75155995 AAGTCTTGGCAAAGGGCCCACGG - Intronic
1140897872 16:79341021-79341043 CCTTCCAGGCAGAGGGACAAAGG + Intergenic
1141064800 16:80905416-80905438 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
1141272631 16:82555132-82555154 CAGTCATGGCAGAAGGCAAAAGG + Intergenic
1141384599 16:83608292-83608314 CAGTTTTCACAAAGGGACAAAGG + Intronic
1141594180 16:85087422-85087444 CAGTCAGGGCAGAGGAAGAAGGG + Intronic
1142207009 16:88788264-88788286 TAGTCTTGGGAGAGCAACAATGG + Intergenic
1142280895 16:89147072-89147094 CAGTCATGGCAGAAGGCAAAGGG + Intronic
1142315298 16:89340753-89340775 AAATCTTGGAAGAGGCACAAGGG + Intronic
1142477896 17:200502-200524 CAGGCTTGGCGGAGGGTCAGGGG + Intergenic
1142896420 17:2981942-2981964 CAGGCTCTGGAGAGGGACAACGG + Intronic
1143823862 17:9588320-9588342 CCATCTTTGCAGATGGACAAGGG + Intronic
1144360395 17:14486595-14486617 CAGTAATGGGAGAGGGAGAAAGG - Intergenic
1144759112 17:17697317-17697339 CAGTCCTGGCCGAGGGGCAGCGG + Intronic
1146514982 17:33482146-33482168 CAGTCATGGCAGAGGGTTCAAGG - Intronic
1146544849 17:33729197-33729219 CAATCCTGGCAGAAGGAGAAGGG + Intronic
1146845242 17:36178308-36178330 CAGTCATGGCAGAAGGCGAAGGG + Intronic
1146873456 17:36390151-36390173 CAGTCATGGCAGAAGGCGAAGGG + Intronic
1146880817 17:36441239-36441261 CAGTCATGGCAGAAGGCGAAGGG + Intergenic
1147065932 17:37922722-37922744 CAGTCATGGCAGAAGGCGAAGGG - Intergenic
1147227571 17:38991631-38991653 CAGTCATGGCAGAAGGCCAAGGG - Intergenic
1147241043 17:39090703-39090725 CAGTCGGGGCAGAGAGAAAAGGG - Intronic
1148249580 17:46064502-46064524 CAGTTTTGGTAGAGGGAGAAAGG - Intronic
1148442455 17:47718545-47718567 CAGCCATGGCAGAGAGAGAAAGG - Intergenic
1149446054 17:56714262-56714284 CAGTCTGGGCAAAGAGACATAGG + Intergenic
1149500972 17:57152128-57152150 CAATCTTGGCAGAAGGCAAAGGG - Intergenic
1151233364 17:72700741-72700763 CAGTCATGGCAGAAGGTGAAAGG + Intronic
1151249666 17:72824303-72824325 CAGTCATGGCAGAAGGCAAAAGG - Intronic
1151335844 17:73439193-73439215 CAATCATGGCAGAAGGAGAAAGG - Intronic
1151832873 17:76565866-76565888 CAATCTTGGCCAAGGGAAAATGG - Exonic
1152465784 17:80465439-80465461 GAGTCTGGGCAGCGGGACACGGG - Intergenic
1154467622 18:14664616-14664638 CAGTCATGGCAGAAGGCGAAGGG - Intergenic
1155338338 18:24788151-24788173 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
1155625512 18:27829909-27829931 CAATCATGGCAGAAGGGCAAAGG + Intergenic
1155808351 18:30200824-30200846 CAATCATGGCAGAAGGCCAAGGG + Intergenic
1156224615 18:35091965-35091987 CAGTCATGGCAGAAGGCCAAGGG + Intronic
1156924950 18:42564714-42564736 CAGTCATGGCAGAAGGGGAAGGG - Intergenic
1157068852 18:44382551-44382573 CAGTCATGGCAGAAGGTGAACGG + Intergenic
1157364434 18:47050871-47050893 CATTCCTGGCAGAGGCACAGAGG + Intronic
1157879114 18:51303299-51303321 TAGTGTTGGAAGAAGGACAAGGG + Intergenic
1158056236 18:53284499-53284521 CAGTCATGGCAGAAGGTGAAAGG - Intronic
1158147841 18:54335830-54335852 CAGTCATGGCAGAAGGTGAAGGG - Intronic
1158748387 18:60227993-60228015 CAGTCGTGGCAGAAGGTGAAGGG + Intergenic
1158900265 18:61955859-61955881 CAGTCATGGCAGAAGGCAAAAGG - Intergenic
1159079113 18:63715275-63715297 TTGTCTTGGCAGAAAGACAACGG + Intronic
1159465915 18:68784251-68784273 CAGTCATGGCAGAAGGCAAAGGG + Intronic
1160010506 18:75104126-75104148 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
1160042328 18:75357139-75357161 CAGTCGTGGCAGAAGGATGAAGG - Intergenic
1160352962 18:78200801-78200823 TACTCTTGGCAGAGGGTGAAAGG + Intergenic
1160546924 18:79664219-79664241 CAGTCATGGCAGAGGGGAAGAGG + Intergenic
1160622594 18:80181281-80181303 CTGACTTGGCTGAGGGACCAGGG - Intronic
1161780949 19:6291546-6291568 CAATCATGGCAGAAGGAGAAAGG + Intergenic
1163062457 19:14770314-14770336 CACTCTTGGCAGACGGGAAAGGG - Intronic
1163130149 19:15267352-15267374 CAAACTTGGAAAAGGGACAAAGG + Intronic
1164453687 19:28388880-28388902 CAGTCATGGCAGAGGGAAAGGGG - Intergenic
1164866302 19:31607092-31607114 CAATCATGGCAGAAGGAAAAAGG - Intergenic
1165024079 19:32946784-32946806 CAGTCATGGCAGAAGGTGAAAGG - Intronic
1165167276 19:33865690-33865712 CACTCATGGCAGAAGGAAAAAGG + Intergenic
1165190622 19:34059945-34059967 CAGTTTTGGCAAAGGGATAATGG + Intergenic
1165194001 19:34087005-34087027 CAATCATGGCAGAGGGCAAAGGG - Intergenic
1165194847 19:34093874-34093896 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1165746354 19:38232134-38232156 CACTCTAGGCAGAGGTGCAAAGG - Intergenic
1166114686 19:40646714-40646736 AAGTCCTGGGAGAGGGACCAGGG - Intergenic
1166242106 19:41501560-41501582 CTGTATTGGCAGAGAGCCAAAGG + Intergenic
1166920274 19:46224459-46224481 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1167346507 19:48948881-48948903 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
1168435389 19:56313309-56313331 CAATCATGGCAGAAGGTCAAAGG + Intronic
925319975 2:2957467-2957489 CAGTCATGGCAGAAGGAGAAGGG + Intergenic
925475589 2:4210842-4210864 CGGTCATGGCAGAAGGAAAAGGG + Intergenic
925485733 2:4328272-4328294 CAGTCATGGCAGAAGGTAAAGGG + Intergenic
925522102 2:4758394-4758416 CAATCATGGCAGAGGGTGAAAGG + Intergenic
926165700 2:10521328-10521350 CAGCCTTATCAGAGGGGCAAGGG + Intergenic
926487122 2:13475640-13475662 CAATCATGGCAGAAGGCCAAGGG + Intergenic
926653423 2:15371214-15371236 CAGTCATGGCAGAAGGCAAAGGG - Intronic
926715064 2:15917865-15917887 CAGTCATGGCCGAGGGTCTAAGG - Intergenic
927031995 2:19130455-19130477 GAGTCTCTGCAGAGGGACATGGG - Intergenic
927127930 2:20030330-20030352 CAGTCGTGGCAGAAGGCAAAGGG + Intergenic
927302982 2:21536887-21536909 CAGTCATGGCAGAAGGTGAAAGG - Intergenic
928197835 2:29227986-29228008 CAGTCCTGGGAGAGGCACCATGG - Intronic
928600433 2:32899017-32899039 ATGTGTTGGTAGAGGGACAAAGG - Intergenic
928766916 2:34657456-34657478 CAGTCTTGTCAGAGCGTCAAGGG + Intergenic
928836673 2:35555789-35555811 CAATCATGGCAGAAGGCCAAGGG + Intergenic
928850794 2:35743278-35743300 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
928883290 2:36121753-36121775 CTGTCTTTGCAGATGGAAAAGGG - Intergenic
929486086 2:42356134-42356156 CATTCTAGGCAGAGGGAACATGG - Intronic
929514082 2:42590420-42590442 CAGTCATGGCAGAAGGTGAAGGG - Intronic
930100256 2:47597770-47597792 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
930960546 2:57254823-57254845 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
931006452 2:57855455-57855477 CAATCTTGGCAGAAGGAAAAGGG + Intergenic
931516288 2:63052229-63052251 CAGGCTTCGCAGAGGGCCAGAGG - Intronic
931939387 2:67235141-67235163 CAGACTAGGCAGGGGAACAAAGG - Intergenic
932792205 2:74663589-74663611 CAGTCATGGCAGAGGGTGAAGGG + Intronic
932872746 2:75419731-75419753 CAGTCTTGGCAGAGGGTCAGTGG + Intergenic
933683970 2:85128353-85128375 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
933863995 2:86499671-86499693 CAGTCATGGCAGAAGGGCGAAGG + Intergenic
933864282 2:86501617-86501639 CAGTCGTGGCGGAAGGGCAAAGG + Intergenic
933933722 2:87181994-87182016 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
933948327 2:87307589-87307611 CACTCATGGCAGAAGGGCAAAGG + Intergenic
934055129 2:88244945-88244967 CAATCTTGGCAGAAGGTGAAAGG - Intergenic
934117963 2:88813711-88813733 CAGTATTGGCAGCGTGAAAATGG + Intergenic
934123006 2:88858084-88858106 CAGTCCTGGAAGAGGCACAGGGG - Intergenic
934784083 2:96992042-96992064 CAGTCATGGCAGAAGGTGAAGGG + Intronic
935047492 2:99495145-99495167 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
935167871 2:100585432-100585454 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
935356083 2:102201064-102201086 CAGTCTTGGCAGAGGGTCTTGGG + Intronic
935730700 2:106062938-106062960 CAGACTTAGCAGCGGGAGAAAGG + Intergenic
935747012 2:106197255-106197277 CAATCATGGCAGAGGGTGAAGGG - Intergenic
935791529 2:106595339-106595361 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
936168708 2:110148310-110148332 CAGTCATGGCAGAAGGTGAAGGG - Intronic
936331872 2:111554006-111554028 CACTCATGGCAGAAGGGCAAAGG - Intergenic
936359388 2:111783450-111783472 CAGTCATGGCAGAAGGCAAAGGG - Intronic
936492700 2:112986249-112986271 CAATCATGGCAGAGGGTGAAGGG - Intergenic
936734093 2:115419368-115419390 CAGTCATGGCAGAAGGAAAAGGG + Intronic
936898119 2:117452219-117452241 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
937868708 2:126772490-126772512 CAATCATGGCAGAAGGAGAAGGG + Intergenic
938225397 2:129611547-129611569 CAGTCTTTGCAGAGGACCCAGGG - Intergenic
939107389 2:137964711-137964733 CAGGCTGGGCACAGGGATAAGGG + Intronic
939137473 2:138314672-138314694 CAATCATGGCAGAGGGCTAAAGG + Intergenic
939614855 2:144350666-144350688 CAGTCCTGGGAGAGGAAGAAGGG + Intergenic
940388359 2:153101374-153101396 CGGTCTTGGCAGAAGTAGAAAGG + Intergenic
941058461 2:160815875-160815897 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
941339580 2:164290277-164290299 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
941693255 2:168523793-168523815 CAGTCTTTGCAGAGGTCTAAAGG - Intronic
941962779 2:171269973-171269995 CAGTCATGGCAGAAGGCAAAAGG + Intergenic
942111105 2:172683467-172683489 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
942139414 2:172963021-172963043 CAATCATGGCAGAGGGCAAAGGG + Intronic
942419855 2:175796473-175796495 CAATCATGGCAGAGGGTGAAAGG - Intergenic
942832244 2:180250961-180250983 GAGTCTGTGCAGAGGCACAAAGG - Intergenic
942980124 2:182070829-182070851 CAGTCATGGCAGAAGGTGAAGGG + Intronic
942991728 2:182209749-182209771 CAGTCGTGGCAGAAGGGCGAAGG - Intronic
943123040 2:183761385-183761407 CAATCATGGCAGAGGGCAAAGGG + Intergenic
943284046 2:185974282-185974304 CAGTCATGGCAGAGCGCAAAGGG + Intergenic
943687051 2:190829712-190829734 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
943817587 2:192276489-192276511 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
943829290 2:192438487-192438509 CAGACCTGGCAGAGTGGCAAAGG + Intergenic
944036844 2:195304574-195304596 CAATCATGGCAGAAGGGCAAGGG - Intergenic
944195602 2:197050088-197050110 CAATCATGGCAGAAGGAAAAGGG + Intronic
945509789 2:210686979-210687001 CAATCATGGCAGAAGGGCAAAGG + Intergenic
945618843 2:212107883-212107905 CAATCATGGCAGAAGGAGAAAGG - Intronic
945984158 2:216340759-216340781 CAGTGTTGGGGTAGGGACAAGGG + Intronic
946122978 2:217532619-217532641 CAATCATGGCAGAGGGCAAAAGG - Intronic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946598381 2:221332100-221332122 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
946879055 2:224159467-224159489 CAATCATGGCAGAAGGGCAAAGG + Intergenic
947032474 2:225812804-225812826 CAGTCATGGCAGAAGGTGAAAGG - Intergenic
947161238 2:227217097-227217119 CAGTCATGGCAGATGGTGAAAGG + Intronic
947226038 2:227841034-227841056 CAGTCATGGCAGAAGGCGAAGGG - Intergenic
947685757 2:232082927-232082949 CAGTCGTGGCAGAAGGTGAAAGG + Intronic
947777152 2:232722287-232722309 CAGTCATGGCAGAAGGAGAAGGG + Intronic
947851928 2:233295181-233295203 CAGGCTTGGCAGAGGGGCCATGG - Exonic
948700754 2:239758129-239758151 CAGTCATGGCAGAAGGTGAAAGG - Intergenic
948760609 2:240188196-240188218 CAGTCATGGCAGAAGGCGAAAGG - Intergenic
1169498148 20:6134171-6134193 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
1169918121 20:10704035-10704057 CAATCATGGCAGAGGGCGAAGGG - Intergenic
1170915487 20:20620371-20620393 GAGTCTTGTCAATGGGACAAAGG - Intronic
1170986151 20:21260907-21260929 CAATCATGGCAGAAGGAGAATGG + Intergenic
1171130247 20:22645549-22645571 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
1171515267 20:25726987-25727009 CAATCATGGCAGAAGGCCAAGGG + Intergenic
1171987620 20:31671418-31671440 CAGTGTTGGCAAAGGCACCAGGG - Intronic
1172315632 20:33951996-33952018 CAATCATGGCAGAAGGGCAAAGG - Intergenic
1172426951 20:34861923-34861945 CAGTCCTGGGGGAGGGGCAAGGG - Intronic
1173146469 20:40529004-40529026 CAGGATTGGCAGAGAGACAACGG - Intergenic
1173678629 20:44860252-44860274 CATTCATGGCAGAGGGCAAAGGG - Intergenic
1173752453 20:45487809-45487831 CAGTCATGGCTGAGGGAGAATGG + Intergenic
1174651248 20:52127555-52127577 CAGTCATGGCAGAAGGCAAAGGG - Intronic
1174656912 20:52179217-52179239 CAGTCATGGCAGAAGGTGAAAGG - Intronic
1174688836 20:52482439-52482461 CAATCATGGCAGAGGGTGAAAGG + Intergenic
1174775644 20:53340830-53340852 CAAGCATGGGAGAGGGACAAAGG + Intronic
1175169052 20:57067158-57067180 CAGTCCTGGCAGAAGGTGAAGGG - Intergenic
1177529559 21:22341845-22341867 CAGTCATGGCAGAAGGATAAGGG + Intergenic
1177532272 21:22375322-22375344 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1177582815 21:23049657-23049679 CATTCATGTCAGAGGGAGAAAGG + Intergenic
1177697726 21:24594858-24594880 CAATCATGGCAGAAGGTCAAAGG - Intergenic
1177846952 21:26300663-26300685 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1178126875 21:29525853-29525875 CAATCATGGCAGAAGGGCAAAGG + Intronic
1178213927 21:30571893-30571915 CAGAATTAGCAGGGGGACAAAGG + Intergenic
1178252808 21:31020742-31020764 CAGGCTGGGTAGAGGGACAACGG + Intergenic
1178379714 21:32097561-32097583 CAATCATGGCAGAAGGAGAAAGG + Intergenic
1179946191 21:44678427-44678449 CAGTCATGGCAGAAGGCAAAAGG - Intronic
1181665944 22:24397168-24397190 CTGTTTTGGCAGAGGGAAAATGG - Intronic
1181796193 22:25312711-25312733 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1181836740 22:25616321-25616343 CAGTCATGGCAGAAGGCAAAGGG + Intronic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1184994706 22:48197049-48197071 CAGTCATGGCAGAAGGTAAAAGG - Intergenic
949494777 3:4621272-4621294 CAGTCATGGCAGAAGGTGAAGGG + Intronic
950498697 3:13350095-13350117 CAGTCATCCCAGAGTGACAAAGG + Intronic
950525240 3:13519287-13519309 GAGTCTGGGGAGTGGGACAATGG + Intergenic
951081409 3:18454383-18454405 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
951528790 3:23679624-23679646 CAGTCATGGCAGAAGGCGAAGGG + Intergenic
952091129 3:29887512-29887534 CAGTCATGGCAGAAGGTGAAGGG - Intronic
952132505 3:30382369-30382391 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
952246970 3:31605596-31605618 CAATCTTGGCAGAAGGTGAAAGG - Intronic
952339899 3:32436757-32436779 CAGACTTGGCAGAGGCACGAGGG + Intronic
952730084 3:36629481-36629503 TAGCCTAGGCAGAGGTACAAAGG + Intergenic
952796913 3:37247510-37247532 AAGTCATGGTATAGGGACAAGGG + Intronic
952870867 3:37899995-37900017 CAGTCTTCTCACAGGGAAAATGG - Intronic
952959481 3:38580538-38580560 CAGTCCTGGAGGGGGGACAATGG + Intronic
953536332 3:43779656-43779678 CACTCATGGCAGAAGGAGAAAGG - Intergenic
953702477 3:45207481-45207503 CAGACTTTGCAGAGAGAGAAAGG + Intergenic
953799506 3:46011525-46011547 GTGTCCTGGCAGAGGGACAGTGG + Intergenic
953898317 3:46822035-46822057 CAATCATGGCAGAAGGAAAAGGG + Intergenic
954499275 3:50995554-50995576 CAGACTTTGCAGAGGAAGAAAGG + Intronic
954927887 3:54253377-54253399 CAGTCATGGCAGAAGGCAAAAGG + Intronic
955031937 3:55230538-55230560 CAGTCTAGGAAGTGGGAGAAGGG - Intergenic
955231020 3:57098729-57098751 AAGTTTTTGCAGAGGGACTAGGG - Intronic
955403609 3:58611109-58611131 CAGTCATGGCAGAAGGCAAAGGG - Intronic
955551679 3:60091799-60091821 CAGTCATGGCAAAGGGAAAGGGG - Intronic
955823549 3:62921615-62921637 CAGTCGTGGCAGAAGGCAAAGGG - Intergenic
956007511 3:64796780-64796802 CAATCATGGCAGAGGGCAAAGGG - Intergenic
956489119 3:69752873-69752895 CAGTCATGGCAGAAGGCAAAAGG - Intronic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
957212075 3:77272348-77272370 CAGTCGTGGCAGAAGGTGAAGGG + Intronic
957222791 3:77406090-77406112 CAGTCATGGCAGAAGGTGAAGGG + Intronic
957535965 3:81503952-81503974 CACTCATGGCAGAAGGAGAAGGG + Intronic
957954927 3:87174034-87174056 CAATCATGGCAGAGGGAGAAGGG - Intergenic
957969337 3:87363055-87363077 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
958469520 3:94499569-94499591 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
958531997 3:95344992-95345014 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
958658990 3:97041723-97041745 CAGTCATGGCAGAAGGTGAAGGG + Intronic
958824182 3:99009805-99009827 CAATCATGGCAGAAGGAAAAGGG + Intergenic
958824654 3:99015976-99015998 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
959399123 3:105877672-105877694 CAGTCTTGGGAAAGGGACTGGGG + Intergenic
959601426 3:108190539-108190561 CAATCATGGCAGAAGGCCAAGGG - Intronic
959814858 3:110663082-110663104 CAATCATGGCAGAAGGCCAAGGG - Intergenic
960341255 3:116478126-116478148 CAGTCATGGCAGAAGGCAAAAGG - Intronic
960947289 3:122975313-122975335 CAGCCTTGGCAGAGGAAGGAAGG + Intronic
962507874 3:136066616-136066638 CAATCATGGCAGAAGGACAAGGG + Intronic
962606594 3:137037378-137037400 CAGGCTTGTCAGACGGACACTGG - Intergenic
962637501 3:137346144-137346166 CATTATGGGCAGTGGGACAAAGG - Intergenic
962874108 3:139522693-139522715 CATTCTAGGCAGAGTGAAAAAGG + Intronic
962980797 3:140487713-140487735 CAGCCTAAACAGAGGGACAAGGG - Intronic
963007416 3:140739028-140739050 TTGTCTTGGCAGAGGGGCAGGGG - Intergenic
963405052 3:144853261-144853283 TAGTCATTGCAGAAGGACAAAGG - Intergenic
963510019 3:146235394-146235416 CAGTCATGGCAGAAGGCAAATGG - Intronic
963547854 3:146684549-146684571 CAATCATGGCAGAGGGTGAAAGG + Intergenic
963683384 3:148409360-148409382 CAATCATGGCAGAGGGTGAAGGG + Intergenic
963816504 3:149837529-149837551 CAATCATGGCAGAGGGTGAAAGG + Intronic
964853526 3:161120085-161120107 CAGTCATGGCAGAAGGCAAAGGG - Intronic
964892435 3:161553167-161553189 CAGGCTTGACTGAGGCACAAAGG + Intergenic
965582022 3:170278789-170278811 CAGTCTTGGCAGAAGGCAAAGGG + Intronic
965813888 3:172617463-172617485 CAATCATGGCAGAAGGCCAAGGG + Intergenic
965886721 3:173455222-173455244 CAATCATGGCAGAGGGTGAAGGG + Intronic
966052156 3:175632342-175632364 CAATCTTGGCAGAAGGTGAAGGG - Intronic
966123884 3:176552748-176552770 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
966400033 3:179538509-179538531 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
967418360 3:189244511-189244533 CAATCATGGCAGAAGGAAAAAGG + Intronic
967646879 3:191935470-191935492 CACTCATGGCAGAAGGAGAAGGG - Intergenic
967866201 3:194192072-194192094 CAATCATGGCAGAAGGCCAAGGG - Intergenic
968014864 3:195320109-195320131 CAGTCATGGCAGAAGGTGAAGGG - Intronic
968156994 3:196389631-196389653 CAGTCATGGCAGAAGGCAAAGGG - Intronic
968378466 4:65799-65821 CAGTCATGGCAGAAAGAAAAGGG - Intronic
968697200 4:2037162-2037184 CAATCATGGCAGAAGGGCAAAGG - Intronic
968698832 4:2045288-2045310 CAGGCTTGGCTGTGGGACACTGG + Intergenic
968858973 4:3151285-3151307 CAGTCATGGCAGAAGGTGAAGGG + Intronic
969041060 4:4296533-4296555 CAATCTTGGCAGAAGGTGAAAGG - Intronic
969194780 4:5551921-5551943 CAATCATGGCAGAGGGAAAGAGG - Intronic
969245240 4:5927686-5927708 CAATCATGGCAGAAGGAGAAGGG - Intronic
969348943 4:6586984-6587006 CTGTCTTTGCAGAAGGACACGGG + Exonic
969390880 4:6890553-6890575 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
969476312 4:7424403-7424425 CAGTGATGCCAGAGGGACAACGG - Intronic
970225022 4:13848948-13848970 CAGTCATGGCAGAAGGCGAAGGG - Intergenic
970528882 4:16962113-16962135 CAGTCATGGCAGAAGGCGAAGGG + Intergenic
971035575 4:22689329-22689351 CAGTCATGGCAGAAGGATGAAGG - Intergenic
971078012 4:23172851-23172873 CAGTCGTGGCAGAAGGCAAAGGG + Intergenic
971983998 4:33795392-33795414 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
972000586 4:34027554-34027576 CAGTCTTCGCAGAAGGTGAATGG - Intergenic
972033766 4:34494664-34494686 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
972406203 4:38748717-38748739 CAATCATGGCAGAAGGACAAAGG - Intergenic
973169093 4:47116853-47116875 CAATCATGGCAGAAGGGCAAGGG + Intronic
973713850 4:53655645-53655667 CAGATTTGATAGAGGGACAAGGG - Intronic
974506264 4:62776825-62776847 CAATCATGGCAGAAGGGCAAAGG - Intergenic
974790351 4:66680657-66680679 CAGTCATGGCAGAAGGGGAAGGG + Intergenic
975923699 4:79423859-79423881 CAGTCATGGCAGAAGGTGAACGG + Intergenic
976327032 4:83783436-83783458 TACTCATGGCAGAGGGCCAAAGG + Intergenic
976536325 4:86222074-86222096 CAGTCATGGCAGAAGGTGAAGGG - Intronic
976546383 4:86340388-86340410 CAGTCATGGCAGAAGGTGAAGGG + Intronic
976591119 4:86850791-86850813 CAATCATGGCAGAGGGGGAAGGG - Intergenic
977116206 4:93031680-93031702 CAATCTTGGCAGAAGAGCAAAGG - Intronic
977168650 4:93732032-93732054 CAGTCTTTACAGAGGAACCACGG - Intronic
977443073 4:97095060-97095082 CAATCATGGCAGAAGGGCAAAGG + Intergenic
977816055 4:101415510-101415532 CAGTCATGGCAGAAGGTGAAGGG - Intronic
978047836 4:104153989-104154011 CAATCATGGCAGAGGGCGAAGGG - Intergenic
978063192 4:104364216-104364238 CAATCATGGCAGAAGGGCAAAGG - Intergenic
978121949 4:105090634-105090656 CAGTCGTGGCAGAAGGCAAAGGG - Intergenic
978256104 4:106694454-106694476 CAATCTTGGCAGAAGGTGAAAGG - Intergenic
978736814 4:112093104-112093126 CAGTCATGGCAGAAGGCAAATGG + Intergenic
978892611 4:113848145-113848167 CAATCATGGCAGAGGGTGAATGG + Intergenic
979236141 4:118402511-118402533 CAATCATGGCAGAAGGCCAAGGG + Intergenic
979280944 4:118866787-118866809 CAGTCGTGGCTGAAGGAGAAGGG - Intronic
979438390 4:120721972-120721994 CCGTCTTTGCAGAGGGACAGAGG + Intronic
980396483 4:132222498-132222520 CAATCATGGCAGAAGGTCAAGGG - Intergenic
980430275 4:132684902-132684924 CAGTCATGGCAGAGAGCAAAGGG + Intergenic
980822499 4:138035991-138036013 CAATCTCCTCAGAGGGACAATGG + Intergenic
982795802 4:159642190-159642212 CAATCATGGCAGAAGGCCAAGGG + Intergenic
983013438 4:162579251-162579273 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
983629703 4:169837556-169837578 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
984631447 4:182065428-182065450 CAGTCACGGCAGAAGGCCAAGGG + Intergenic
984843727 4:184092415-184092437 CACTCTGGGCAGAGGCACAGTGG - Intronic
986455413 5:7913296-7913318 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
987465388 5:18265953-18265975 CAGTCATGGCAGAAGGCTAAGGG + Intergenic
987563073 5:19549332-19549354 CAGTCATGGCAGAAGGTGAAGGG - Intronic
987619214 5:20318636-20318658 CAGTCATGGCAGAAGGTGAAGGG - Intronic
987681645 5:21143721-21143743 CAATCATGGCAGAGGGTGAAGGG - Intergenic
988517577 5:31918030-31918052 CAGTCATGGCAGAAGGTGAAGGG + Intronic
988721099 5:33879944-33879966 CAGCCCTGGCACAGGGACCAAGG + Intronic
989087866 5:37695107-37695129 CAGTCTTGGTAGAAGGCAAAGGG + Intronic
989198880 5:38743142-38743164 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
989732295 5:44663553-44663575 CAGTATGGGCAGAGAGAAAAAGG + Intergenic
990057597 5:51603482-51603504 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
990135908 5:52644132-52644154 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
991285819 5:64974380-64974402 CAATCATGGCAGAGGGTGAAAGG + Intronic
991562834 5:67972611-67972633 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
991587003 5:68211780-68211802 CAATCATGGCAGAAGGAGAAAGG + Intergenic
992134811 5:73733896-73733918 CAGTCATGGCAGAAGGTGAAGGG + Intronic
992375141 5:76181543-76181565 CAATCTTGGCAGAAGGTGAAGGG + Intronic
992448661 5:76856090-76856112 CAGTCATGGCAGAAGGCAAAGGG - Intronic
992745938 5:79820340-79820362 CAATCATGGCAGAGGGTGAAAGG - Intergenic
992843085 5:80715682-80715704 CAGTCGTGGCAGAAGGTGAAGGG + Intronic
993753129 5:91694911-91694933 CAATCATGGCAGAAGGACGAAGG + Intergenic
994019165 5:95003676-95003698 CAGTCATGGCAGAAGGTAAAGGG - Intronic
994286133 5:97970604-97970626 CACTCTTGACAGAGGGACCTAGG - Intergenic
994589454 5:101755183-101755205 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
994621672 5:102171575-102171597 CAATCATGGCAGAGGGAGAAAGG - Intergenic
994626787 5:102230147-102230169 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
994739464 5:103599968-103599990 CAGGTTTGGTAGAGGGATAAAGG - Intergenic
994870627 5:105345624-105345646 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
995200176 5:109416063-109416085 CAGTCATGGCAGAAGGTGAAAGG - Intergenic
995392258 5:111652495-111652517 CAATCATGGCAGAGGGTGAAAGG + Intergenic
995774472 5:115710991-115711013 CAATCATGGCAGAAGGAGAAAGG + Intergenic
995862964 5:116661147-116661169 GAGGCTTGGGAGAGGGACTAAGG + Intergenic
996013256 5:118503989-118504011 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
996222535 5:120950827-120950849 CAGTCATGGCAGAGGCAAAGAGG - Intergenic
996913321 5:128680238-128680260 TAGTTTTGGCAGAGGTTCAAAGG - Intronic
997046833 5:130329265-130329287 CAATCATGGCAGAAGGGCAAAGG - Intergenic
997067100 5:130574055-130574077 CAGGCCTAGAAGAGGGACAAGGG + Intergenic
997376770 5:133403130-133403152 CTGTCTTGGGAGAGAAACAAAGG - Intronic
997731436 5:136181990-136182012 CATTCATGGCAGAGTGAAAAAGG + Exonic
998230966 5:140361174-140361196 GTGTCTGGGCAGAGGGAGAAGGG + Intronic
998381233 5:141727124-141727146 CAGTCATGGCAGAAGGTAAAGGG + Intergenic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
998661684 5:144245799-144245821 CAGTCATGGCAGAAGGTGAAGGG - Intronic
999420597 5:151439067-151439089 CAGTCATGGCAGAAGGTGAAGGG + Intronic
999461600 5:151761436-151761458 CAGGCTTGGGAGAGGGAGCATGG + Intronic
999499615 5:152133616-152133638 AGGTCATGGCAGAGGGACACTGG - Intergenic
1000011865 5:157240669-157240691 CAGTCATGGCAGAAGGCAAAAGG + Intronic
1000101672 5:158022701-158022723 CAGACATGGCAGAGGGAGATGGG - Intergenic
1000243425 5:159429398-159429420 CAATCATGGCAGAGGGCAAAGGG + Intergenic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1000561229 5:162791933-162791955 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1000575545 5:162970762-162970784 CAATCATGGCAGAAGGAGAAGGG - Intergenic
1001338105 5:170817834-170817856 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
1001627653 5:173149732-173149754 CAGTCATGGCAGAAGGCAAAGGG + Intronic
1002213184 5:177610371-177610393 CACTTTTGGCTGAGGGGCAAGGG + Intergenic
1002315838 5:178342446-178342468 CAGTCTGGGCAGTGGCTCAAAGG + Intronic
1002806110 6:575558-575580 CAGTCATGGCAGAAGGCAAAAGG - Intronic
1002840305 6:899708-899730 TAATCATGGCAGAGGGAAAAGGG - Intergenic
1002857187 6:1048364-1048386 CCTTGTGGGCAGAGGGACAAGGG + Intergenic
1003008676 6:2405813-2405835 CAATCTTGGCAGAAGGTGAATGG + Intergenic
1003800831 6:9665018-9665040 CAGTCATGGCAGAAGGTGAAGGG - Intronic
1003897841 6:10624319-10624341 CAATCCTGGCAGAGGGCAAAAGG + Intronic
1004039405 6:11960918-11960940 GAGTTTTGGCAGAGGCTCAAAGG - Intergenic
1004040823 6:11973120-11973142 CAGTCTTGACAGTGGGGCATTGG + Intergenic
1004523569 6:16384757-16384779 CAATCATGGCAGAAGGAGAAGGG - Intronic
1004700703 6:18076927-18076949 CAATCATGGCAGAGGGCAAAAGG + Intergenic
1004815711 6:19309916-19309938 CAATCATGGTGGAGGGACAAAGG - Intergenic
1004942542 6:20575393-20575415 CAGTCTTGTCAGTGTGATAAGGG + Intronic
1005078231 6:21929760-21929782 CAGTCATGGCGGAAGGAGAAGGG + Intergenic
1005217131 6:23543543-23543565 CAATCATGGCAGAAGGGCAAAGG - Intergenic
1005984659 6:30863693-30863715 CAATCTGGGCAGAAGGGCAAGGG - Intergenic
1006488307 6:34363546-34363568 GAGTCTTGGCAGTGGGAAACAGG + Intronic
1007719504 6:43876788-43876810 CTGTCCAGGCAGAGAGACAAAGG - Intergenic
1007811917 6:44492266-44492288 CAATCTTGGCAGAAGGAGAAAGG - Intergenic
1008486263 6:52039473-52039495 CAGTCATGGCAGAAGGTGAAGGG - Intronic
1008692113 6:53991065-53991087 CAGTCATGGCAGAAGGCAAAGGG - Intronic
1009294823 6:61933121-61933143 CAGTCATGGCAGAAGGCAAAGGG + Intronic
1009527244 6:64763332-64763354 CAATCATGGCAGAGGGCAAAAGG + Intronic
1009821893 6:68813229-68813251 CAATCATGGCAGAGGGTCAAAGG - Intronic
1009824195 6:68845696-68845718 CAATCATGGCAGAGGGTGAAAGG - Intronic
1010655761 6:78508695-78508717 CAGTCATGGCAGAAGGTGAAAGG - Intergenic
1010676892 6:78755778-78755800 CAGTCTTGGCAGAAGGTGAAGGG - Intergenic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1010851787 6:80785609-80785631 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1011290869 6:85775922-85775944 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1012011670 6:93795576-93795598 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
1012163049 6:95911884-95911906 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
1012191064 6:96280380-96280402 CAATCATGGCAGAAGGGCAAAGG - Intergenic
1012200633 6:96402058-96402080 CAATCATGCCAGAAGGACAAAGG - Intergenic
1012222984 6:96673486-96673508 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1012239176 6:96852629-96852651 CAGTATTGCCAGAGAGAGAATGG - Intergenic
1012330975 6:97986819-97986841 AAGTCCTGGCAGAAGGAAAATGG + Intergenic
1012900952 6:105005654-105005676 CAGTCATGGCAGATGGCAAAGGG - Intronic
1013459516 6:110361523-110361545 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1013477626 6:110523667-110523689 CAATCATGGCAGAAGGTCAAGGG - Intergenic
1013810554 6:114040041-114040063 CAGACTTGCCACAGGGACAGTGG - Intergenic
1013827471 6:114231340-114231362 CAGTCATGGCAGAAGGCAAAGGG - Intronic
1013859302 6:114615477-114615499 CTGTTTTGGCAGAAAGACAAAGG - Intergenic
1013890392 6:115020202-115020224 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
1014068382 6:117152805-117152827 CAATCATGGCAGAAGGGCAAAGG + Intergenic
1014082601 6:117304966-117304988 CAATCATGGCAGAGGGTGAAGGG - Intronic
1015309257 6:131747930-131747952 CAATCATGGCAGAAGGAGAAGGG + Intergenic
1015415348 6:132941345-132941367 CAGTCATGGCAGAAGGCCAAGGG - Intergenic
1015981934 6:138847958-138847980 CAGTCATGGCAGAAGGCTAAGGG + Intronic
1016752648 6:147648226-147648248 CAGTCATGGCAGAAGGCAAAAGG + Intronic
1016862688 6:148736706-148736728 CAGGCTTGGGAGAGGGACATGGG - Intergenic
1017122690 6:151039232-151039254 CAGTGTTGGCACAGGGAGAAGGG + Intronic
1017218658 6:151940098-151940120 CAGTCATGGCAGAAGGTGAAGGG + Intronic
1017798380 6:157868990-157869012 CAGTCTTGGGAGAGGTACCCTGG + Intronic
1018035737 6:159879556-159879578 CAGTCATGGCAGAAGGCAAATGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018481428 6:164194948-164194970 CAATCATGGCAGAGGGCGAAGGG + Intergenic
1018549629 6:164980849-164980871 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1019183394 6:170207126-170207148 CAGGAGTGGCACAGGGACAAAGG + Intergenic
1019457930 7:1140680-1140702 CAGTCTTGGCGGAAGGCAAAAGG - Intergenic
1019947242 7:4339553-4339575 CAGTCATGGCAGAAGGTCAAAGG - Intergenic
1020030292 7:4927969-4927991 CAGTCTGGGAAGACAGACAAGGG + Intronic
1020719306 7:11721448-11721470 CAGTCATGGCAGAAGGCAAAGGG - Intronic
1020981068 7:15069753-15069775 CAATCATGGCAGAAGGAGAAGGG + Intergenic
1021035127 7:15788637-15788659 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
1021645955 7:22789667-22789689 CAGACTTGGTAGAGGGGAAATGG - Intergenic
1022030429 7:26487491-26487513 CTGGCTTTGCAGAGAGACAAGGG - Intergenic
1022218689 7:28290702-28290724 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1022596574 7:31718750-31718772 CAGACCTGGCAGCTGGACAAGGG + Intergenic
1023060307 7:36320400-36320422 CAGTCATGGCAGAAGGTGAAAGG - Intergenic
1023179272 7:37465376-37465398 CAATCATGGCAGAGGGTGAAAGG + Intergenic
1023235308 7:38080602-38080624 CAATCTTGGCAGAAGGTGAAGGG + Intergenic
1023512779 7:40970816-40970838 GAGTCTTGGGAGAAGGACAAGGG + Intergenic
1024459917 7:49649377-49649399 CAGTCATGGCAGAAGGGGAAGGG + Intergenic
1024814990 7:53257794-53257816 CAATCATGGCAGAGGGTGAAAGG - Intergenic
1026181786 7:68048045-68048067 CAGTCATGGCAGAAGGTGAAAGG - Intergenic
1026189958 7:68116659-68116681 CAGTCATGGCAGAAGGTGAATGG - Intergenic
1026549147 7:71352242-71352264 CAGTCATGGCAGAAGGTAAAAGG - Intronic
1026633383 7:72058662-72058684 CACCCTGGGCAGAGGGCCAAGGG + Intronic
1027288623 7:76677457-76677479 CAGGCCTGGGAGAGGGAAAACGG - Intergenic
1027507827 7:79040258-79040280 CAGTCATGGCAGAAGGCAAAGGG - Intronic
1027695582 7:81405603-81405625 CAGTCATGGCAGAGGGTGAGGGG + Intergenic
1027991563 7:85369485-85369507 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1028245129 7:88468128-88468150 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1028859841 7:95636775-95636797 CTGTCTAGGCAGAGAGACAAAGG - Intergenic
1029864940 7:103617965-103617987 CACTCCTGGCAGAAGGAGAAGGG - Intronic
1029867347 7:103648336-103648358 CAATCATGGCAGAAGGCCAAAGG - Intronic
1030014084 7:105201072-105201094 CAGTCCTGGCAGAGGGTGAGGGG + Intronic
1030184033 7:106741926-106741948 CAGTTTTAGCAGAAGGATAAAGG - Intergenic
1030587347 7:111436852-111436874 CAGTCATGGCAGAAGGTGAAGGG + Intronic
1030654199 7:112148280-112148302 GAGTGCTGGCAGAGGGACAGGGG + Intronic
1031363451 7:120874942-120874964 CAATCATGGCAGAAGGGCAAAGG + Intergenic
1031388947 7:121189362-121189384 CAATCATGGCAGAAGGAGAAGGG + Intronic
1031637696 7:124120898-124120920 CAATCATGGCAGAAGGAGAAGGG - Intergenic
1032372245 7:131368496-131368518 CAGTCATGGCAGAAGGCAAAGGG + Intronic
1032380503 7:131474892-131474914 CAGTCATGGCAGAAGGTGAAGGG + Intronic
1032660947 7:133983084-133983106 CAGTCATAGCAGAAGGAAAAGGG + Intronic
1032887635 7:136158693-136158715 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
1033562748 7:142548049-142548071 CAATCATGGCAGAAGGAGAAGGG - Intergenic
1033790784 7:144790526-144790548 CAATCGTGGCAGAAGGAGAAGGG + Intronic
1034039349 7:147860672-147860694 CAGTCATGGCAGAAGTAGAAGGG - Intronic
1034531486 7:151698604-151698626 CAGTCATGGCAGAAGGCAAAGGG - Intronic
1034681346 7:152930897-152930919 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1034700933 7:153095128-153095150 CAGTCACGGCAGAAGGAGAAAGG + Intergenic
1034740414 7:153468207-153468229 CATTGATGGCAGAGGGATAAAGG + Intergenic
1034880875 7:154761603-154761625 CAGTCACGGCAGAAGGCCAATGG + Intronic
1034894482 7:154867333-154867355 CTGTCGCGGCAGAGGCACAAAGG + Intronic
1035135165 7:156696540-156696562 CAGTCATGGCAGAGGGCGAAAGG + Intronic
1035235369 7:157494474-157494496 CACTCTTGGCAGAAGGTGAAGGG + Intergenic
1035822903 8:2614105-2614127 CAGTCATGGCAGAAGGCGAATGG - Intergenic
1035885002 8:3282006-3282028 CAGTCATGGCAGAAGGTAAAGGG - Intronic
1038084071 8:24174188-24174210 CAGCCTGGGCAGAGTGTCAACGG + Intergenic
1038375607 8:27037318-27037340 AAGTTTTGGTAGAGGGACAAAGG + Intergenic
1038646401 8:29365824-29365846 CAGGCTTGGCTGAGGGGCAGTGG - Intergenic
1039226109 8:35390079-35390101 CAGTCATGGCAGAAGGCAAAGGG + Intronic
1039273278 8:35906676-35906698 CTGTCTTTGCAGATGGACAGAGG - Intergenic
1040838514 8:51758702-51758724 CAGTCATGGCAGAAGGTGAAGGG - Intronic
1040994554 8:53388746-53388768 CAGTCTTGCAAAATGGACAAGGG + Intergenic
1041203235 8:55471829-55471851 CAGTCATGGCAGAAGGCAAAGGG - Intronic
1041426024 8:57721587-57721609 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1042466534 8:69134721-69134743 CAATCATGGCAGAGGGCAAAAGG + Intergenic
1042801727 8:72725712-72725734 CAGTCTGGGCAGAAGGACCGGGG - Intronic
1042887227 8:73565344-73565366 CAGTCATGGCAGATGGCAAAGGG - Intronic
1043074865 8:75685231-75685253 CAATCGTGGCAGAGGGCGAATGG - Intergenic
1043811870 8:84751750-84751772 CAATCTTGGCACAGGGCAAAGGG - Intronic
1044492434 8:92835331-92835353 CATTCATGGCAGAGGGTGAAGGG - Intergenic
1044550818 8:93510544-93510566 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1044727388 8:95204494-95204516 CGGTCTTTGCAGATGGACAGGGG + Intergenic
1044923487 8:97189345-97189367 CAATCATGGCAGAAGGCCAAGGG + Intergenic
1045561979 8:103272419-103272441 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
1046268020 8:111857649-111857671 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1046457609 8:114487300-114487322 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
1046520983 8:115325642-115325664 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1047260246 8:123251227-123251249 CAGTCATGGCAGAAGGCGAAGGG - Intronic
1047562338 8:126001174-126001196 CAGTCGTGGCAGAAGGCAAAAGG + Intergenic
1047635689 8:126759653-126759675 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1048025066 8:130578503-130578525 CTGGCTTGGCAGAGGGACCAGGG + Intergenic
1048068210 8:130993701-130993723 CAATCATGGCAGAAGGAGAAAGG - Intronic
1048113212 8:131490633-131490655 CAGTCTAGGCACAGGCACAGGGG - Intergenic
1048591561 8:135825339-135825361 CAGTCATGGCAGAAGGCAAATGG - Intergenic
1048838267 8:138541996-138542018 CAGTCATGGCAGAGAGTGAAAGG + Intergenic
1048895623 8:138989811-138989833 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1049568440 8:143355929-143355951 CACTCTTAGAAGAGGGATAAAGG + Intronic
1049770518 8:144378507-144378529 CAGTCATGGCAGAAGGCAAATGG - Intronic
1049800356 8:144514783-144514805 CAGTCTTGGCAGCAGGTCAAAGG - Intronic
1050099275 9:2100909-2100931 CAGTCATGGCAGAAGGTGAAAGG + Intronic
1050444283 9:5702412-5702434 CAGTCATGACAGAAGGAGAAGGG + Intronic
1050945284 9:11510025-11510047 CAATCATGGCAGAGGGTGAAGGG - Intergenic
1051079381 9:13278492-13278514 CGTTCTTTGCAGAGGCACAAAGG - Intronic
1051339511 9:16098534-16098556 CAGTTTTGGCATATGTACAATGG + Intergenic
1051510672 9:17874604-17874626 CAATCATGGCAGAAGGAGAAGGG + Intergenic
1051517266 9:17943880-17943902 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1051656317 9:19385344-19385366 CAGTGTTGGCACAGTGAAAAAGG + Intergenic
1052070853 9:24080110-24080132 CAATCATGGCAGAGGGCAAAAGG - Intergenic
1052127937 9:24801744-24801766 CAGTCGTGGCAGAAGGTGAAGGG - Intergenic
1052161934 9:25273048-25273070 CAGTCATGGCAGAGGTAAAGGGG - Intergenic
1052502078 9:29304815-29304837 CAATCATGGCAGAAGGAGAAGGG + Intergenic
1052637395 9:31122461-31122483 CAGTCATGGCAGATGGCAAAAGG + Intergenic
1053274112 9:36770557-36770579 CAGGCTGGGCAGAGGGGGAAGGG + Intergenic
1053432373 9:38051463-38051485 AATTCAAGGCAGAGGGACAAAGG + Intronic
1055366634 9:75550951-75550973 CAGTCATGGCAGAAGGTAAAGGG - Intergenic
1055493253 9:76827611-76827633 CAGTCATGGGGGAGGGAAAATGG + Intronic
1056005276 9:82263061-82263083 CAATCATGGCAGAGGGTGAAAGG + Intergenic
1056120518 9:83483268-83483290 CAGTCATGGCAGAAGGGCAAAGG - Intronic
1056283815 9:85068471-85068493 CAGTCATGGCAGAAGGTGAAAGG - Intergenic
1056286333 9:85091241-85091263 CAATCATGGCAGAAGGAAAAAGG - Intergenic
1056604242 9:88072812-88072834 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1058346543 9:103970242-103970264 CAGTCATGGCAGAAGGCGAAGGG - Intergenic
1058637610 9:107051576-107051598 CATTGTTGGCAGAGGGACAGAGG + Intergenic
1058721914 9:107772229-107772251 CAATCATGGCAGAAGGGCAAAGG + Intergenic
1058782704 9:108354244-108354266 CAGTCATGGCAGAAGGAGAAGGG - Intergenic
1059110606 9:111555612-111555634 CAGTCATGGCAGAAGGGCAAAGG + Intronic
1059110782 9:111556796-111556818 CAATCATGGCAGAAGGGCAAAGG - Intronic
1059175654 9:112167867-112167889 CAGTCATGGCAGAAGGCAAAAGG + Intronic
1059184362 9:112253800-112253822 CAGTCATGGCAGAAGGCGAAGGG - Intronic
1059427388 9:114229665-114229687 CAGTCATGGAGGATGGACAAGGG + Intronic
1059548283 9:115201266-115201288 AAGCCTGGGCAGAGGCACAAAGG + Intronic
1059789056 9:117620013-117620035 CAATCATGGCAGAGGGCAAAGGG + Intergenic
1059855378 9:118391378-118391400 GAGTCTTTGGAAAGGGACAATGG + Intergenic
1059862365 9:118478968-118478990 CAGTCTTGGATCTGGGACAATGG + Intergenic
1060178499 9:121515288-121515310 CAATCATGGCAGAGGGCAAAAGG + Intergenic
1060557048 9:124513426-124513448 CGGGCTTGGGTGAGGGACAAAGG + Intergenic
1061777137 9:132973122-132973144 CAGTCCTGGGAATGGGACAATGG - Intronic
1203570772 Un_KI270744v1:128451-128473 CAGTCATGGCAGAAAGAAAAGGG + Intergenic
1185786231 X:2893300-2893322 CAGTCATGGCAGAAGGCAAAGGG - Intergenic
1185872656 X:3676921-3676943 CAGTCATGGCAGAAGGTAAAAGG - Intronic
1185880798 X:3739013-3739035 CAATCTTGGCAGAAGGCAAAAGG + Intergenic
1185924185 X:4128290-4128312 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1186007105 X:5084912-5084934 CAATCGTGGCAGAAGGGCAAGGG + Intergenic
1186268509 X:7858797-7858819 CAATCATGGCAGAGGGTGAAGGG + Intergenic
1186461109 X:9749290-9749312 CAATCGTGGCAGAAGGCCAAGGG - Intronic
1186663284 X:11691582-11691604 CAATCATGGCAGAAGGCCAAAGG + Intergenic
1186935719 X:14448783-14448805 CCGTCTTTGCAGATGGACAAGGG + Intergenic
1187578958 X:20588143-20588165 CAGTCATGGCAGAAGGCAAAGGG + Intergenic
1188217698 X:27499610-27499632 CAATCATGGCAGTGGGGCAAAGG + Intergenic
1188510525 X:30931393-30931415 CAGTCATGGCAGAAGGCAAAGGG + Intronic
1188646382 X:32572971-32572993 CAATCATGGCAGAAGGAGAAGGG - Intronic
1188674094 X:32917214-32917236 CAATCTTGGCAGAAGGTGAAGGG - Intronic
1188856098 X:35197863-35197885 CAATCATGGCAGAAGGGCAAAGG - Intergenic
1188972037 X:36629761-36629783 CAATCGTGGCAGAAGGGCAAAGG - Intergenic
1189078863 X:37947476-37947498 CAATCATGGCAGAGGGTGAAGGG - Intronic
1189621153 X:42839755-42839777 CACTCATGGCAGAAGGAGAAGGG + Intergenic
1189872127 X:45394931-45394953 CAGTCATGGCAGAAGGTAAAGGG + Intergenic
1190310408 X:49113492-49113514 CAGTCCTGGGACAAGGACAAGGG - Exonic
1191586498 X:62833084-62833106 CAGTCATGGCAGAGGTTAAAGGG + Intergenic
1191734328 X:64373456-64373478 CAGTCATGGCAGAAGGTGAAGGG - Intronic
1191734875 X:64378025-64378047 CAGTCATGGCAGAAGGTGAAGGG - Intronic
1192595002 X:72397032-72397054 CAATCATGGCAGAGGGCAAATGG + Intronic
1192607134 X:72529968-72529990 CAGTCTTGGCAGAGGGACAAAGG - Intronic
1192920148 X:75697694-75697716 CAGTCATGGCAGAAGGTGAAAGG + Intergenic
1193046248 X:77057983-77058005 CAATCATGGCAGAAGGATAAGGG - Intergenic
1193096432 X:77554602-77554624 CAGTTTGGGCAAAGGGACAGAGG - Intronic
1193960523 X:87919695-87919717 CACTCATGGCAGAAGGGCAATGG + Intergenic
1193985770 X:88238514-88238536 CAATCATGGCAGAAGGAGAAGGG - Intergenic
1194399192 X:93421953-93421975 CAGACTTGGGATAGGGAGAAGGG - Intergenic
1194429056 X:93777981-93778003 CATTCTAGCCAGAAGGACAAAGG + Intergenic
1194627604 X:96243771-96243793 CACACTTGGAAGAGGGCCAAGGG + Intergenic
1194898405 X:99474155-99474177 CAGTCATGGCAGAAGGTGAAGGG - Intergenic
1195008026 X:100706063-100706085 CAGTTGTGGCAGAGGGATGAAGG - Intronic
1195241908 X:102960509-102960531 CAGTCTTGGCAGGGTGATTAAGG - Intergenic
1195422116 X:104687305-104687327 CAGTCATGGCAGAAGGTGAATGG + Intronic
1195576936 X:106461869-106461891 CAATCATGGCAGAAGGAGAAGGG + Intergenic
1195815398 X:108879311-108879333 CAGTCATGGCAGAAGGGGAAGGG + Intergenic
1196060461 X:111402892-111402914 CTATCTTGACAGGGGGACAAAGG + Intronic
1197535024 X:127676852-127676874 CAATCATGGCAGAAGGAGAAGGG + Intergenic
1198611084 X:138401417-138401439 CAGTCATGGCAGAAGGTGAAGGG + Intergenic
1198674768 X:139120133-139120155 CAGTCTTGGCAGAAGGCTATGGG - Intronic
1199306333 X:146270826-146270848 CAATCTTGGGAGAAGGCCAAAGG - Intergenic
1199326680 X:146506932-146506954 CAATCTTGGCAGAAGGCAAAAGG + Intergenic
1199603194 X:149555475-149555497 CAGTCATGGCAGAAGGCAAAAGG - Intergenic
1199647194 X:149924000-149924022 CAGTCATGGCAGAAGGCAAAAGG + Intergenic
1199858131 X:151777020-151777042 CACTCTTGGGAGTGGGAGAAAGG - Intergenic
1200791272 Y:7301739-7301761 CAGTCATGGCAGAAGGTAAAAGG + Intergenic
1201621489 Y:15963889-15963911 CAATCATGGCAGAAGGAAAAGGG + Intergenic
1201748399 Y:17405587-17405609 CAGCCAAGGCAGAGAGACAAAGG - Intergenic
1201928511 Y:19316031-19316053 CAATCTTGGTAGAAGGAAAAAGG + Intergenic