ID: 1192611201

View in Genome Browser
Species Human (GRCh38)
Location X:72569110-72569132
Sequence TTTACTTACCTATAAACTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 340}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192611201_1192611202 14 Left 1192611201 X:72569110-72569132 CCTTGAGTTTATAGGTAAGTAAA 0: 1
1: 0
2: 0
3: 40
4: 340
Right 1192611202 X:72569147-72569169 TTCAAGTTAAACAAATAATCAGG 0: 1
1: 0
2: 2
3: 34
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192611201 Original CRISPR TTTACTTACCTATAAACTCA AGG (reversed) Intronic
900850364 1:5137660-5137682 TTTCCTTACCTATAAAATGGGGG + Intergenic
901366467 1:8754972-8754994 TTTGCTTACCTATAAACCAGTGG - Intronic
903535727 1:24064986-24065008 TTTACTCATCTGTAAAATCATGG + Intronic
904032320 1:27540853-27540875 CTTCCTTGCCTATAAAATCAAGG - Intronic
905596175 1:39209483-39209505 TTTCCTTACCTGTAAAGTGAAGG + Intronic
905868372 1:41388669-41388691 TTTACTTACCAAGAAACAGAGGG - Intergenic
906676326 1:47696232-47696254 TTTATTTATCTATAAACTGGGGG - Intergenic
906979288 1:50611570-50611592 TTTACTTCAATTTAAACTCAAGG + Intronic
907097520 1:51795278-51795300 TTTTCTTATCTATAAAATAAGGG + Intronic
907822722 1:57986931-57986953 TATACTTACCTATGAATTAAGGG - Intronic
908090389 1:60679305-60679327 TTTTCTTATCTATAAAATTAGGG + Intergenic
908157518 1:61369946-61369968 TTTATTTCCATATAAACTGATGG - Intronic
908458589 1:64327651-64327673 TTTCCTTATCTATAAAATGAGGG + Intergenic
908483094 1:64563361-64563383 TTTACTCAAGTATACACTCAAGG + Intronic
909040995 1:70651465-70651487 TTTCCTTACCTGTAAAATGAGGG + Intergenic
909635725 1:77814878-77814900 TTTCTTTACCTATAAAATTAAGG - Intronic
910317848 1:85907829-85907851 TTTATTTATCTATTAACCCAAGG + Intronic
912171822 1:107109741-107109763 TTTAATTACCAATACAGTCAGGG + Intergenic
915425984 1:155827189-155827211 TTTACTCATCTGTAAACTCAGGG + Intronic
916471190 1:165124393-165124415 TTTTCTCATCTATAAACTGAGGG + Intergenic
918488434 1:185054280-185054302 TTTCCTTACCTGTAAACTGGGGG - Intronic
919628722 1:199938305-199938327 CTCACTTAGCTATGAACTCATGG + Intergenic
919629598 1:199947378-199947400 TTTCCTTACCTATAAAATGTGGG + Intergenic
920202018 1:204265444-204265466 CTTCCTTACCTATAAAATGAGGG - Intronic
920856440 1:209666335-209666357 TTTCCTCACCTATAAACATAGGG + Intergenic
921676272 1:217979878-217979900 TTTTCTTACCTATAAAATAGAGG - Intergenic
921696045 1:218211911-218211933 TGTACTTATATATAAACACAGGG - Intergenic
921918012 1:220634458-220634480 TTTTCTTATCTATAAAATGAGGG + Intronic
922407328 1:225328763-225328785 GTTACTTACATATTAACGCATGG - Intronic
922688573 1:227667857-227667879 TTTTCTTCCCTATAATTTCATGG - Intronic
923600998 1:235402968-235402990 TTTACTAACCTTTAAAATGAAGG + Intronic
923848406 1:237764194-237764216 TTTCCTTATCTATAAAATCAAGG - Intronic
924544860 1:245016966-245016988 TTTACATACGCATATACTCATGG - Intronic
1063710413 10:8471828-8471850 TTTCCTTGCCTATTAATTCAAGG - Intergenic
1064279731 10:13940789-13940811 TTTTCTTATCTATAGATTCATGG + Intronic
1065053895 10:21823621-21823643 TTTACTTACATATAAACCAAGGG + Intronic
1065668270 10:28086285-28086307 TTTACTTTCCTTTAAATTCTGGG - Intronic
1067019793 10:42785022-42785044 TTTTCTTACCCATAAAATGAGGG - Intronic
1067739735 10:48886167-48886189 TTTTCCTACCTATAAAATCAGGG + Intronic
1067933757 10:50590144-50590166 TTTACTTACCTTTCAAATGATGG + Exonic
1068009792 10:51433946-51433968 TTTTCTTACCTATAAAGTAAAGG - Intronic
1068108899 10:52655022-52655044 TTTTCTTACCTATAAAATGAAGG - Intergenic
1069162449 10:65108418-65108440 TTTACTTACCTCCAACCTGATGG - Intergenic
1071212151 10:83355735-83355757 TTTACTTAACTTGGAACTCAGGG + Intergenic
1072411686 10:95208463-95208485 TTTACTTTTGTATAAACTTAAGG - Intronic
1072492873 10:95925388-95925410 TTTGCTTACATAGGAACTCAGGG + Intronic
1073988446 10:109236216-109236238 TTTAAATATCTATAAAATCATGG - Intergenic
1074275200 10:111994865-111994887 TTTTCTTACATAGCAACTCAGGG - Intergenic
1076008622 10:126968411-126968433 TTTTCTTACCTACAAAATCATGG + Intronic
1078583812 11:12562312-12562334 TTTCCTTATTTATAAAGTCAAGG + Intergenic
1078691111 11:13581925-13581947 TTTACTTACCAATAATAACATGG + Intergenic
1078852224 11:15175258-15175280 TTTTCTTAGCTATAAACTTTTGG + Intronic
1079453273 11:20616157-20616179 TTTTCTTTCCTGTAGACTCAGGG + Intronic
1080116901 11:28631494-28631516 TTTGCTCACCTATAAAATGAAGG + Intergenic
1080527222 11:33135591-33135613 TTTACTCACATATAAAATGAGGG + Intronic
1080894071 11:36434601-36434623 TATACTTACCTATATACTTCTGG + Intronic
1081900295 11:46621763-46621785 TTTACCTACCTATAAGGTTAAGG + Intronic
1082648458 11:55756990-55757012 TTTCCTCACCTATAACCTGAGGG + Intergenic
1085057381 11:73413564-73413586 TTTACTTATCTATAAAATAAAGG + Intronic
1085556402 11:77426458-77426480 TTTTCTTACCTGTAAAATGAGGG - Intronic
1086204304 11:84239480-84239502 TTTACTTATCTTTAAATTCCAGG - Intronic
1086534691 11:87830743-87830765 TTTCCTTATCTATAAAATGATGG - Intergenic
1086999270 11:93397141-93397163 TTTCCTTAGCTATAAAATGAGGG + Intronic
1087154603 11:94888326-94888348 TTCACTTAACTATGAACTCTAGG + Intergenic
1087399163 11:97642892-97642914 TATACTTATCTTCAAACTCATGG + Intergenic
1088830720 11:113534069-113534091 TTTCCTTACCTGTAAAGTGATGG - Intergenic
1089802853 11:121050929-121050951 TATACTGCCCTAGAAACTCATGG + Intronic
1089921018 11:122209652-122209674 TTTTCCTACTTATAAATTCAAGG - Intergenic
1090597072 11:128331286-128331308 TTTCCTAACCTATAAAATGAGGG + Intergenic
1090843137 11:130509970-130509992 TTTCCTGATCTGTAAACTCAGGG - Intergenic
1091832611 12:3560640-3560662 TTTACTTCCCAGAAAACTCAAGG + Intronic
1093229932 12:16531650-16531672 TTTAAGTCCCTAAAAACTCAAGG - Intronic
1094794291 12:33952541-33952563 TTTCCTTACCTATAAAATGCAGG + Intergenic
1095263594 12:40127110-40127132 GTTAATTATCTATAAACTCCTGG + Intergenic
1095627833 12:44338634-44338656 TTTAATTTCCTTTACACTCATGG - Intronic
1096236116 12:49928331-49928353 TTTTCTCATCTATAAACTAAGGG - Intergenic
1097260468 12:57716969-57716991 TTTTCTTACCCATAAAATGAGGG + Intronic
1097420443 12:59372231-59372253 TTTTCTTAAATATAAATTCAAGG - Intergenic
1097484366 12:60176261-60176283 ATCACTTACCTATAAAATGAGGG - Intergenic
1098396184 12:70019433-70019455 TTTACTTATCAATAAAAACATGG + Intergenic
1098989968 12:77054875-77054897 TTTACTCACCTGTAAAATGAGGG - Intronic
1099221596 12:79921230-79921252 TTTACTAAGCTAGAATCTCAGGG - Intronic
1099227472 12:79986880-79986902 TTTACTTTTCTGTAAACTCTTGG + Intergenic
1100280014 12:93109438-93109460 TTTCCTTACCTATAAAATAAGGG - Intergenic
1100359143 12:93860310-93860332 TTTACTTTCCTAGAGAATCATGG + Intronic
1101476815 12:105058527-105058549 TTTCCTTTCATATATACTCAGGG + Intronic
1102601669 12:114036182-114036204 TTTCCTCACCTATAAAATTAGGG - Intergenic
1102743414 12:115228322-115228344 TTTCCTTATCTCTAAAATCAAGG - Intergenic
1103432666 12:120902549-120902571 TTTCCTTACCTATAAAATAGAGG - Intronic
1104241785 12:126997174-126997196 TTTCCTTCCCCATAAACTCCTGG - Intergenic
1104518898 12:129454599-129454621 TTGACTTACACATGAACTCAAGG - Intronic
1104989489 12:132617610-132617632 TGTTGTTACCTAGAAACTCAAGG + Intergenic
1106246775 13:27956838-27956860 TTTACTTACCAATAAAATACTGG + Intergenic
1107866406 13:44707500-44707522 TTTACATCACTATAGACTCATGG + Intergenic
1107966808 13:45604516-45604538 TTTCCTTACCTATGAAGTGAGGG - Intronic
1108548619 13:51521225-51521247 TTTACCTTCCTATAAACTGCAGG - Intergenic
1109073436 13:57800858-57800880 TTTACTTGACTTAAAACTCACGG - Intergenic
1109098080 13:58143683-58143705 ATTCCTTACCAATAAATTCAGGG + Intergenic
1109146203 13:58782715-58782737 TTTACTTATTTGTAAAATCAAGG + Intergenic
1110081210 13:71315570-71315592 ATTACTTCCCTAAAAACACACGG - Intergenic
1110192007 13:72740904-72740926 TTTCCTTATCTATAAAATGATGG + Intronic
1113526487 13:110982328-110982350 TTTACTGACCTTCAAATTCAAGG - Intergenic
1115601969 14:34963753-34963775 TTTACTTTCCAATAAAATCAGGG + Intergenic
1116025203 14:39506524-39506546 TTTACTCATCTATAAAATAATGG - Intergenic
1116414351 14:44662617-44662639 TTTCCTTACCTATAAAGTGTTGG + Intergenic
1116645013 14:47516233-47516255 TTTAATTTCCTGTAAACTCATGG - Intronic
1116669225 14:47819468-47819490 CTTACTTACCAATAATATCATGG - Intergenic
1116743358 14:48784735-48784757 TTTATTTAGCCATAAATTCACGG + Intergenic
1117631788 14:57701007-57701029 TTTATGTACCTATAAAGACAGGG + Intronic
1118010291 14:61603864-61603886 TCTGCTTACCTAGGAACTCAAGG - Intronic
1118058008 14:62102637-62102659 TCTACTTCCCTTTAAACACAAGG - Exonic
1119190824 14:72680556-72680578 TTTACTTTCCCATATATTCACGG - Intronic
1120324338 14:83006258-83006280 TTTCCTGACCTATTAAGTCAAGG + Intergenic
1120912119 14:89676768-89676790 TTTCCTCACCTATAAAATTAGGG - Intergenic
1122197381 14:100098831-100098853 TTTCCTTACCTATAAAATCGGGG + Intronic
1125044777 15:35232658-35232680 TTTAGTTACCTATAGAATCTTGG - Intronic
1125303945 15:38289076-38289098 TTTAGTTACCTCTAAACCAATGG + Intronic
1126686346 15:51251908-51251930 TTTCCTTATCTATAAAATGAGGG + Intronic
1129451387 15:75653074-75653096 TTTACTCACCTAGAGACTGAGGG - Intronic
1129550873 15:76447825-76447847 TTTACTTACCTGTGAACTCTGGG - Intronic
1130033639 15:80338480-80338502 TTTCCTTAACTATTAATTCAAGG - Intergenic
1130182516 15:81645039-81645061 TTTACTTACCTATGTCATCATGG + Intergenic
1135903893 16:26492713-26492735 TTTACTCATCTATAAAATGAGGG - Intergenic
1137022009 16:35437476-35437498 TTTACTTAGGTGGAAACTCAAGG + Intergenic
1137385336 16:48036652-48036674 TTTCCTTTCCTGTAAACTTAAGG - Intergenic
1137509264 16:49084065-49084087 TTTCCTTATCTATAAAATGAAGG - Intergenic
1140132768 16:72178574-72178596 TTTACATCACTATGAACTCATGG + Intergenic
1140706590 16:77636330-77636352 TTTAATGAACTATAAACTCTGGG + Intergenic
1140865132 16:79053750-79053772 TTTGCATAACTATAAACTTAAGG - Intronic
1143588226 17:7862837-7862859 TGTAATTACCTATAGAGTCAGGG + Intronic
1147486060 17:40815731-40815753 TTTACTTACCTATACAATAAGGG - Intergenic
1147589450 17:41672313-41672335 TTTACTTACATAGAAACCCAGGG - Intergenic
1149028636 17:52059322-52059344 TTTCCTCACCTATAGAATCAGGG - Intronic
1149786595 17:59440689-59440711 TTTACTTATCTGTAAAATGAAGG + Intergenic
1150880015 17:69013929-69013951 TTTGTCTACCTATGAACTCAAGG + Intronic
1151672433 17:75578786-75578808 TTTACTTATCTGTAAAGTGAAGG + Intergenic
1152262913 17:79276887-79276909 TTTACTTGCCTAAGGACTCAGGG + Intronic
1153459164 18:5314663-5314685 TTTCCTTACCTATAAAATAGAGG - Intergenic
1155418876 18:25632423-25632445 TCTACTGAACTACAAACTCAAGG + Intergenic
1155695808 18:28684794-28684816 TTTCCCTACCTACACACTCAAGG - Intergenic
1156184079 18:34640990-34641012 TTTACATATCTATAAACTTGGGG + Intronic
1156272793 18:35552402-35552424 TTTTCTTACCTATAACAACAGGG + Intergenic
1158470686 18:57734083-57734105 ATAACTTACCTATTAACTTAAGG - Intronic
1159117468 18:64132123-64132145 TTTATTTACATAAAAACTGAAGG + Intergenic
1161860450 19:6794015-6794037 TTTATTTACCAATAAACCAACGG + Intronic
1161860453 19:6794045-6794067 TTTATTTACCAATAAACCAACGG + Intronic
1161860456 19:6794075-6794097 TTTATTTACCAATAAACCAACGG + Intronic
1165539827 19:36483645-36483667 ATTATTTACCTATGGACTCATGG - Intronic
1166232675 19:41434435-41434457 TTTACATACCTAGAAACTGAGGG + Intronic
1167398900 19:49251849-49251871 TTTTCTTACCTATAAAGTGGTGG + Intergenic
1168520475 19:57046403-57046425 TTTTCCTACCTGTAAAATCAGGG - Intergenic
926959169 2:18335211-18335233 TTTCTTTACTTATACACTCAAGG + Intronic
927026785 2:19076521-19076543 TTTACTTACCTAGAAAATTAAGG + Intergenic
928041984 2:27887866-27887888 TTTATTTATCTAAAAACTGAAGG + Intronic
928059341 2:28095166-28095188 TTTCCTCACCTATAAAATGACGG - Intronic
928498795 2:31864705-31864727 TTTACCAACCTGAAAACTCAGGG + Intergenic
930207511 2:48602706-48602728 TTTCCTGACCTCTAAACTCCAGG - Intronic
930334210 2:50024934-50024956 GTTACTCACCTATAAAGTGAAGG + Intronic
930340493 2:50107935-50107957 TTTCCTTACCTATTAAGTGAAGG - Intronic
930810184 2:55531968-55531990 TTTACTTACATTTAAACATAAGG + Intronic
931596886 2:63956911-63956933 TTTAGTTACCTTGAAACTTAGGG - Intronic
931799167 2:65741785-65741807 TTTACTTATCTTTAAAGTAAAGG + Intergenic
933260753 2:80128690-80128712 TTTTCTTCTCTATAAGCTCAGGG + Intronic
933553651 2:83806480-83806502 TTTCCTCAGCTATAAAATCAAGG + Intergenic
933799767 2:85951576-85951598 TTTCCTTAGCTGTAAACTGAGGG + Intergenic
934965140 2:98714984-98715006 TTTACATAAGTATGAACTCATGG - Intronic
935429724 2:102962429-102962451 TTTATTTATCTGTAACCTCAGGG + Intergenic
937335530 2:121059985-121060007 TCTCCTTATCTGTAAACTCAGGG + Intergenic
937582771 2:123508339-123508361 TTAACTTACATATAAATTCCAGG - Intergenic
940238731 2:151540040-151540062 TTTACTTATCCATAAAATTATGG - Intronic
940619053 2:156087840-156087862 TTTACTAAGCTATAATTTCAAGG + Intergenic
941495879 2:166202567-166202589 TTTATTAATCTATAAATTCAAGG - Intronic
942356825 2:175124246-175124268 TTTATTGAGCTATATACTCAAGG - Intronic
942549472 2:177100009-177100031 TTTCCTTACATATAAAAACAGGG - Intergenic
943043484 2:182830372-182830394 TTTACTTTTCTACAAATTCAAGG + Intergenic
943369037 2:186992915-186992937 TTTACTTAACCATAACCTAAGGG - Intergenic
943557268 2:189421158-189421180 TTTACTTAAAGATAAACACATGG + Intergenic
943596710 2:189866596-189866618 TTTAGGTACCTATAAAGTAAGGG + Intronic
944088680 2:195879432-195879454 TTAAATCACCTATAAACTCCTGG - Intronic
944518287 2:200534818-200534840 TTTCCTCACCTCTAAACTCTGGG + Intronic
944544882 2:200789276-200789298 TTTTCTTATCTATAAAATGAGGG + Intergenic
944822691 2:203446601-203446623 TTTACATCAGTATAAACTCATGG + Exonic
944945599 2:204681310-204681332 TTTAATTACATATAAAATGAGGG - Intronic
946595607 2:221302691-221302713 TTGACTTACCAATGAACTTAAGG - Intergenic
946915678 2:224518356-224518378 TTTGCTTATCTATAAGCTGATGG + Intronic
1169666053 20:8037284-8037306 TTTACTTACCAATAAAGAAAAGG - Intergenic
1169765801 20:9146717-9146739 TTTACTTACTTAGGAACCCAAGG + Intronic
1169888020 20:10423100-10423122 TTTTCTGAACTATAAACTCAAGG + Intronic
1171142137 20:22752538-22752560 TTTATTTGCCTAGACACTCATGG + Intergenic
1172407521 20:34700758-34700780 TTTCCTCACCTATAAAATGAGGG + Intronic
1172744421 20:37195530-37195552 TTTTCTTACCTGTAAACTTAAGG + Intronic
1174482739 20:50842723-50842745 TCTTCTCACCTATAAACTGAGGG - Intronic
1175336719 20:58200942-58200964 TTTAGTTAACTTTAATCTCAAGG - Intergenic
1177481661 21:21697398-21697420 TTTAGTAACCAATAAACTCAGGG - Intergenic
1177519655 21:22202797-22202819 TTCACTTACATCCAAACTCATGG - Intergenic
1177525352 21:22283541-22283563 TTTCCTTACTTGTAAATTCAAGG + Intergenic
1182578005 22:31286559-31286581 TTTATTTTCCTGTAAACTCAGGG - Intronic
1183914018 22:41102219-41102241 TTCCCTTATCTATAAACTCCAGG - Intronic
949649875 3:6144735-6144757 TTTTCTCAGCGATAAACTCATGG + Intergenic
949937436 3:9126911-9126933 TTTATTTACGTATAAATTTATGG - Intronic
950167418 3:10812105-10812127 TTTCCTTATCTGTAAAATCAGGG - Intergenic
950621365 3:14208112-14208134 TTTATATAACTATGAACTCATGG - Intergenic
952687127 3:36162934-36162956 TTTCCTCACCTATAAAATGAAGG - Intergenic
952960827 3:38588182-38588204 TTTCCTTACCTATAAACTGCAGG - Intronic
952993087 3:38849340-38849362 TCTACTTAACTGTAAACTCATGG + Intronic
954061250 3:48069353-48069375 TTTCCTTATTTATAAAATCAAGG - Intronic
954350151 3:50036567-50036589 TTTACTGAGCTATAATATCATGG - Intronic
955101263 3:55852360-55852382 TTATCTTACCTATAAAATAAGGG - Intronic
955567943 3:60269912-60269934 TGTAATTAGTTATAAACTCATGG + Intronic
956267747 3:67416181-67416203 GTCACTTATCAATAAACTCAAGG + Intronic
956771831 3:72533200-72533222 TGTCCATAGCTATAAACTCAAGG + Intergenic
956807062 3:72825706-72825728 TTTAGTTAACTAGAAACTCAAGG + Intronic
957280836 3:78149447-78149469 TTTGCTTACATATAAACCCAGGG - Intergenic
957477319 3:80741393-80741415 TCTACCTACATGTAAACTCAGGG - Intergenic
957508896 3:81161552-81161574 TTTACTTACCTATAAAATGGGGG + Intergenic
957559178 3:81799712-81799734 TTTTCTTATCTATAAAATAAAGG - Intergenic
958711188 3:97718920-97718942 TTTGCTCACTTATAAAATCAAGG + Intronic
959058913 3:101597948-101597970 TATACTTACATATAAAATGAGGG - Intergenic
959126599 3:102297151-102297173 TTTCCTCACCTATAAAATTAGGG + Intronic
959393650 3:105807835-105807857 TTTACTTATCTAATAATTCATGG - Intronic
959677044 3:109048139-109048161 TTTTCTTACAAATAAACTTAAGG + Intronic
959887882 3:111523479-111523501 TTTCCTTACATATAAAATTATGG - Intronic
960037122 3:113113000-113113022 TATACATACCTATAAACACATGG + Intergenic
960287297 3:115844090-115844112 TTTTATTACCTATAAAATGAGGG + Intronic
960308979 3:116097592-116097614 ATTACTTACTTATTTACTCATGG - Intronic
960428611 3:117540832-117540854 TATGCTAACCTATAAAGTCAAGG + Intergenic
960554748 3:119015546-119015568 TTTACTTACCTCTAAAATAGAGG - Intronic
961127269 3:124430921-124430943 TTTGCTTCCCTATCAACTCTTGG - Intronic
962020491 3:131495893-131495915 TTTTCTTACCCATAAAAACAAGG - Intronic
962166748 3:133057523-133057545 TCTTCTCACCAATAAACTCATGG - Intronic
963130348 3:141852149-141852171 GTTACGTTCCAATAAACTCATGG + Intergenic
963810910 3:149775507-149775529 TTTACTAACCTTTAGGCTCATGG - Intronic
964783323 3:160365027-160365049 TTCACATAACTATAAACTAAAGG + Intronic
965085725 3:164094739-164094761 TTTCCTCACCTATAAAATGAGGG - Intergenic
965221732 3:165934699-165934721 TTTAGTTGCTTATAAACTTAAGG - Intergenic
965447555 3:168794282-168794304 TTTTCTCACCTATAAAATAAAGG - Intergenic
966054427 3:175666254-175666276 TTTTCTTCTCTATAAAATCAGGG - Intronic
966081358 3:176006053-176006075 TTTCCTCACCTATAAATTAAGGG + Intergenic
966659615 3:182399789-182399811 TTTCCTTACCTCTAACCTAATGG - Intergenic
966920496 3:184608214-184608236 TTTTCTCACCTATAAATTTAGGG - Intronic
967992432 3:195141496-195141518 TCAAATTACGTATAAACTCAAGG + Intronic
968263737 3:197345860-197345882 TTTACATACCTATAAAATCCAGG + Intergenic
969685265 4:8669522-8669544 TATACTTACCTGTAAACACTGGG - Intergenic
969855324 4:9994622-9994644 TATTCTTACCTATAAAATGAGGG - Intronic
970195823 4:13549007-13549029 TTTTCTTACCTAAAAAGCCAGGG + Intergenic
970842211 4:20487738-20487760 GTTCCTTATCTATAAGCTCAAGG + Intronic
971531373 4:27693212-27693234 TTTACTTAGCTTTAAAGTGAGGG + Intergenic
971747360 4:30600632-30600654 TATACTAACTTATAAACTTAGGG - Intergenic
972032440 4:34478319-34478341 TTTTCTTATCCATAAATTCAAGG - Intergenic
972065464 4:34938124-34938146 TATACTTACCTATAAAATTTGGG - Intergenic
973049630 4:45579455-45579477 TTTTCTTACAAATAAACACAAGG + Intergenic
973697476 4:53504852-53504874 TTTACTGACCTATAAGGGCATGG + Intronic
974117392 4:57596686-57596708 TTTATTTACCTTAAAAATCATGG + Intergenic
974696472 4:65381519-65381541 TTTAATCACTTAAAAACTCATGG - Intronic
974755485 4:66201284-66201306 TTTACTTAACCATAAAATAAAGG - Intergenic
975046792 4:69814860-69814882 TCTTCTTAACTATAAAATCAAGG + Intronic
975078467 4:70244022-70244044 TTTTCTTACCTGTAAAACCAGGG - Intronic
975560724 4:75705847-75705869 TTTACTGCCCTTAAAACTCATGG + Intronic
975634503 4:76433322-76433344 TGTCCTTACCTCTAAAATCAAGG + Intergenic
976166007 4:82255622-82255644 TTTTCTGACATATGAACTCACGG + Intergenic
977436913 4:97009478-97009500 TTTCCTGACCTATGTACTCATGG - Intergenic
978146622 4:105381034-105381056 TTCACTTGCCTAAAAACTCTTGG + Intronic
978639502 4:110852976-110852998 TTTTATTATCTATAAAGTCAGGG + Intergenic
978788734 4:112638660-112638682 ATTACTCACCTATAATCTTATGG - Intronic
980024631 4:127750418-127750440 ATTATTTCCTTATAAACTCATGG + Intronic
980319220 4:131246770-131246792 TATACTTTCCTATAAAACCAAGG + Intergenic
980546336 4:134267928-134267950 TTTAGGTAACTCTAAACTCAAGG - Intergenic
980566020 4:134542619-134542641 TTTTCTTACCTATCAACACCAGG - Intergenic
983814982 4:172113059-172113081 TTTACCTACCTATATATTCTCGG - Intronic
983815135 4:172116184-172116206 TTTTTTTACCTAAAAATTCACGG - Intronic
984579519 4:181495116-181495138 TTAACTAAACTATAAACTCAAGG - Intergenic
984687200 4:182683189-182683211 TTTACTCATCTGTAAAATCATGG + Intronic
984779411 4:183510838-183510860 TTCACTTACCTATAAACCAAAGG + Exonic
984796241 4:183662453-183662475 TTTATATACTTATAAAGTCAGGG + Intronic
987246124 5:16050688-16050710 TTTGCTTACACAGAAACTCAAGG + Intergenic
987679710 5:21119128-21119150 TTTACTTCCCAATTAACTTACGG + Intergenic
989506248 5:42230272-42230294 TTTACTTATCTTAAAACCCATGG + Intergenic
990760483 5:59124161-59124183 TTTCCTTACTTATAAACTGAGGG + Intronic
992045797 5:72887769-72887791 TATACTTACCTAAAGAATCAAGG - Intronic
992415067 5:76544450-76544472 TTAACCTACATATAAAATCAAGG + Intronic
993082757 5:83322325-83322347 TTTAATTGCATATAAAGTCATGG - Intronic
993316833 5:86418879-86418901 TTTACTCACCTATAAAATGGAGG + Intergenic
993747505 5:91619335-91619357 TTTGCTTACCTAAGAATTCAAGG - Intergenic
994412353 5:99423098-99423120 TTTTCCTACCTGTAAAATCAGGG + Intergenic
994481467 5:100342157-100342179 TTTTCCTACCTGTAAAATCAGGG - Intergenic
995370472 5:111412888-111412910 TTTAATTACATATAAATTAAGGG - Intronic
995677518 5:114679581-114679603 TTTAAATAAATATAAACTCATGG + Intergenic
995921988 5:117325713-117325735 CTTACTCATCTATAAACTGAAGG - Intergenic
997948247 5:138221297-138221319 TTTACTTACCTCTAAATGGATGG - Intergenic
998856882 5:146402210-146402232 TTTACTCATCTATAAAGTGAGGG + Intergenic
998909511 5:146943485-146943507 TTTACTTTCTTACAACCTCATGG - Intronic
999187943 5:149726757-149726779 TTTTCTTATCTATAAAATGAAGG - Intergenic
1000267706 5:159653556-159653578 GTTACCTACCTATAAACCCAAGG - Intergenic
1000528015 5:162382702-162382724 TTTCCTTATCTATAAAATGAAGG - Intergenic
1003208980 6:4042149-4042171 TTTTCTCACCTATAAAATGATGG - Intronic
1003846620 6:10180789-10180811 TGTAATTACCTATAGACTCTTGG - Intronic
1004041540 6:11982964-11982986 TTTAATTACCTGTGAACACAAGG + Intergenic
1004181416 6:13383664-13383686 TTTGCTTACATAGAAACCCAAGG - Intronic
1004482747 6:16036837-16036859 TTTATTTAGCTATAACCACATGG + Intergenic
1007824966 6:44593574-44593596 TTTCCTTATCTATAAAATCAAGG - Intergenic
1008919821 6:56831005-56831027 TTTCCTTGCCTATAAAATAAGGG + Intronic
1009927694 6:70139802-70139824 TTTCTTTATCTATAAAATCATGG - Intronic
1010340197 6:74741348-74741370 TATAATTATCTATAAAGTCAAGG + Intergenic
1010866609 6:80983358-80983380 TTTAATTACATATAAAGTAAGGG - Intergenic
1011976442 6:93305914-93305936 AGTACTTACCTAGAAACTCCTGG + Intronic
1012452288 6:99365115-99365137 TTTACATCCATATAGACTCATGG - Intergenic
1012910303 6:105110295-105110317 TTTACTCATCTATAAAATGAGGG + Intronic
1013246400 6:108291268-108291290 TTTTCTTATCTATAAAATTAGGG - Intergenic
1013541797 6:111117821-111117843 TTTACTTACCTGTAAAGTGAAGG - Intronic
1015354592 6:132262677-132262699 TTTTCTTTCCTATAAAGTAATGG - Intergenic
1015386843 6:132634505-132634527 TTTACTCAGCTATAAAGTGAGGG - Intergenic
1015409585 6:132877852-132877874 TAAACTCACCTATAAACTGAAGG + Intergenic
1015810038 6:137153294-137153316 TTCACCTTCCTATAAAGTCATGG - Intronic
1015825032 6:137302224-137302246 TTTGCTTACATAGAAACCCAAGG - Intergenic
1016124368 6:140382190-140382212 TTTAATTACTTATAAAATAAAGG + Intergenic
1017524328 6:155229469-155229491 TTTACTTGCCTATAAAAGCAGGG - Intronic
1018312119 6:162521380-162521402 TTTAATTGTCTATAAACTAAAGG + Intronic
1019912883 7:4111913-4111935 TTTCCTTAACTATAAAATGAAGG - Intronic
1020060789 7:5150260-5150282 TTTCCTTCCCAATAAATTCATGG + Intergenic
1020167553 7:5820002-5820024 TTTTCTTCCCAATAAATTCATGG - Intergenic
1022051332 7:26676524-26676546 TTTCTTTACCTATAAAGTGAAGG + Intronic
1023061878 7:36335382-36335404 TCTACTTTCCCTTAAACTCATGG - Intronic
1023463339 7:40425409-40425431 TTTTTTTACCTATAAATTTAGGG - Intronic
1024810721 7:53208418-53208440 TTCTCTTATCGATAAACTCATGG - Intergenic
1026291041 7:69006379-69006401 TTTATTTACTTGGAAACTCAGGG - Intergenic
1027997487 7:85443592-85443614 TTGAGTTACATATAAACACAGGG + Intergenic
1028417129 7:90593090-90593112 TTTTCTTATCTATAAAATGAGGG - Intronic
1030339867 7:108365056-108365078 ATTACATACCTACAAGCTCATGG + Intronic
1030752263 7:113242339-113242361 TTTACTTGCTTATAGACTGAAGG + Intergenic
1031127985 7:117795861-117795883 TTGATATACCTATAAACACATGG + Intronic
1031982728 7:128138584-128138606 TTTAGCTGCATATAAACTCAGGG - Intergenic
1032060918 7:128724396-128724418 TTTACTTACCTACTCACCCAAGG + Intronic
1032869459 7:135967572-135967594 TTTCCTTATCTATAAAATAAGGG + Intronic
1033591675 7:142813555-142813577 ATTATTTACCTGTAAACTAAAGG + Intergenic
1034259961 7:149748961-149748983 ATTTATTAACTATAAACTCATGG - Intergenic
1035099143 7:156382232-156382254 TTTCCTTACCTAAAAAGTCGGGG - Intergenic
1037431826 8:18821422-18821444 AATAGTTACCTATAATCTCAAGG - Intronic
1039225387 8:35383137-35383159 TTTCCTTGTCTATAAAATCAGGG - Intronic
1040641695 8:49342155-49342177 TTGACATATCTATAAACTCTTGG - Intergenic
1041405194 8:57491240-57491262 TTTACTTACTTCTGAACTGAAGG + Intergenic
1042854302 8:73250348-73250370 ATTACTTACATATAAATTCAGGG + Intronic
1043094889 8:75955079-75955101 TTTACCTACCTATAACATAAAGG - Intergenic
1043743886 8:83848676-83848698 TTTAATTAACTAGAAACTAATGG + Intergenic
1043812601 8:84759687-84759709 TTTTCTTACTTATAAAATGAGGG + Intronic
1044016356 8:87052105-87052127 TTTACAGGCCTATAAACTCCAGG - Intronic
1044110052 8:88261914-88261936 TTTAGTTATTTATAACCTCATGG - Intronic
1045948623 8:107826597-107826619 TTTATGTACATATAAACTGATGG - Intergenic
1046193062 8:110823507-110823529 TTTACTTACCCACAAGTTCATGG - Intergenic
1046474467 8:114723414-114723436 CTTACTTCCCTATAAGCTCAAGG + Intergenic
1047322704 8:123803001-123803023 TTTCCTTACCTTTAAAATGAAGG + Intronic
1047587405 8:126288499-126288521 TTGTCTTATCTATAAACTGAAGG - Intergenic
1047956644 8:129981662-129981684 TTCCCTCACCTATAAAATCAGGG - Intronic
1048100109 8:131341846-131341868 TTGACTGACCTATAAGCTCCTGG - Intergenic
1048603670 8:135945577-135945599 TTTTCTTACCTCAAAAGTCAGGG - Intergenic
1048697660 8:137046539-137046561 TTTACTTCCCAATAGACTAAAGG - Intergenic
1048766549 8:137850934-137850956 ATTAATTAACTAGAAACTCAAGG - Intergenic
1050747027 9:8888394-8888416 TTTTCTTACCACTAAATTCAAGG + Intronic
1052046322 9:23798419-23798441 TTTCCTTACCTATAAAATGGCGG + Intronic
1052496735 9:29235707-29235729 TTCACTTAACTGAAAACTCATGG + Intergenic
1055904453 9:81276581-81276603 TTTTCTTACCTATAAAATGAAGG + Intergenic
1057973819 9:99582602-99582624 TTTCCTTACCTGTAAAATTAGGG - Intergenic
1058923111 9:109637004-109637026 TTTCTTTACCTATAAAATGAGGG - Intergenic
1059182180 9:112226882-112226904 TTTAGTTATCTTCAAACTCAGGG - Intronic
1059313259 9:113402861-113402883 TTTAGTTACCAATAACCTCAGGG - Intergenic
1060124149 9:121025652-121025674 TTTACTAACCTCTAAATTGAAGG + Intronic
1061290127 9:129646021-129646043 TTTCCTCACCTATAACCTGAGGG + Intergenic
1186278742 X:7969367-7969389 TTGAGTTCCCTATAAACTCTAGG - Intergenic
1188762374 X:34048785-34048807 TATATTTACCAATAATCTCATGG - Intergenic
1189238682 X:39508567-39508589 TTGACTTACCTATAAAATGGAGG + Intergenic
1189238847 X:39509902-39509924 TTGACTTACCTATAAAATGGAGG + Intergenic
1190553909 X:51614758-51614780 TTTCCTTACCTATGACCCCAGGG + Intergenic
1192144682 X:68673852-68673874 TCTGCTTACCCATAACCTCAGGG - Intronic
1192161123 X:68788575-68788597 TTTCCTTAACTATAAAATGAGGG + Intergenic
1192611201 X:72569110-72569132 TTTACTTACCTATAAACTCAAGG - Intronic
1194499372 X:94660745-94660767 TTTGCTTACATGGAAACTCAAGG + Intergenic
1195575176 X:106441261-106441283 GCTACTTACCTGAAAACTCAGGG - Intergenic
1195604257 X:106784556-106784578 TTTACTTATCTATAAAATGAGGG - Intronic
1196607518 X:117672851-117672873 TTTTCTTACCTATAAAATAGAGG + Intergenic
1197805193 X:130392178-130392200 TTTCCTAACCTGTAAAATCAAGG - Intergenic
1199696107 X:150343653-150343675 TTTTCTTACCTATAAAATGCAGG + Intergenic
1200294554 X:154905328-154905350 TTAACTTACATATCAACTCCTGG - Intronic