ID: 1192612603

View in Genome Browser
Species Human (GRCh38)
Location X:72582484-72582506
Sequence CATCCTTGTCCTCACCATGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 168}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192612603_1192612608 12 Left 1192612603 X:72582484-72582506 CCAGCATGGTGAGGACAAGGATG 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1192612608 X:72582519-72582541 AGCTGACGGTACTCTGGCTGAGG 0: 1
1: 0
2: 2
3: 5
4: 74
1192612603_1192612609 25 Left 1192612603 X:72582484-72582506 CCAGCATGGTGAGGACAAGGATG 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1192612609 X:72582532-72582554 CTGGCTGAGGTACACGATTCAGG 0: 1
1: 0
2: 1
3: 8
4: 46
1192612603_1192612605 -2 Left 1192612603 X:72582484-72582506 CCAGCATGGTGAGGACAAGGATG 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1192612605 X:72582505-72582527 TGGCTTCAACCAGCAGCTGACGG 0: 1
1: 1
2: 2
3: 22
4: 252
1192612603_1192612606 6 Left 1192612603 X:72582484-72582506 CCAGCATGGTGAGGACAAGGATG 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1192612606 X:72582513-72582535 ACCAGCAGCTGACGGTACTCTGG 0: 1
1: 1
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192612603 Original CRISPR CATCCTTGTCCTCACCATGC TGG (reversed) Exonic
900611982 1:3548126-3548148 CATCTGCGTCCTCAGCATGCTGG - Intronic
903356261 1:22749654-22749676 CATCCTTCCCCTCTCCATCCTGG - Intronic
906045949 1:42830922-42830944 CATCCTGGTCCTTCCCATCCCGG - Exonic
907552345 1:55314928-55314950 CAGCCATGCCCTCCCCATGCTGG - Intergenic
907688482 1:56637807-56637829 CCTCCTTGTCCACACCACTCTGG + Intronic
910047760 1:82938487-82938509 CCTCCTCCTCCTCACAATGCTGG - Intergenic
910238730 1:85063307-85063329 GCTCCTGGTCCACACCATGCAGG - Intronic
910841732 1:91567842-91567864 CATCCTTGGCTTCAACATGGAGG + Intergenic
911375178 1:97043621-97043643 CATCCTGGTCTTCACCAGGAAGG - Intergenic
914430990 1:147620116-147620138 CATCCTGTTCATCTCCATGCTGG - Exonic
915772687 1:158445399-158445421 CATCTTTTTCCTCAGCATTCTGG - Intergenic
919863318 1:201758049-201758071 TTTTCTTGTCCTCACCATGAGGG + Intronic
919968892 1:202558315-202558337 CATCCTTGTCCCTAGGATGCTGG - Intronic
921051230 1:211513272-211513294 CATGCTGCTTCTCACCATGCAGG + Intergenic
922222935 1:223622201-223622223 AATCCATGTCCCCATCATGCAGG - Intronic
922478220 1:225921515-225921537 CACCCTGGTCCTGAACATGCGGG + Intronic
922566462 1:226604742-226604764 CAGCCTTGTCTGCACTATGCAGG - Exonic
923500585 1:234560612-234560634 CATCCTTTTCCTCAGCCTCCCGG + Intergenic
1062862436 10:821414-821436 CATTCTGGACCTCCCCATGCAGG + Intronic
1065952897 10:30668045-30668067 AGTCCTTGTTCTCACCAAGCAGG + Intergenic
1067118220 10:43451996-43452018 AGTCCTTGTTCTCATCATGCAGG - Intronic
1067440498 10:46306722-46306744 CATGTCTGTCCTCAGCATGCAGG - Intronic
1069069354 10:63977570-63977592 CATCCCTGTCATCACCCAGCTGG + Intergenic
1070279410 10:75037850-75037872 CATCCTCCTCCTCACCGTCCTGG + Exonic
1071161546 10:82751935-82751957 CATATTTGTCCTCAACAAGCTGG - Intronic
1071281298 10:84106456-84106478 CTGCATTATCCTCACCATGCTGG + Intergenic
1073249492 10:102113180-102113202 GAGCCCTGTCCTCACAATGCAGG + Intronic
1075410910 10:122227390-122227412 CATCATTGTTCTCACCACCCTGG - Intronic
1076369048 10:129940224-129940246 CCTCCTCCTCCTCACCTTGCAGG + Intronic
1076739991 10:132478263-132478285 CCTCCTGCTCCTCACCCTGCTGG + Intergenic
1077266610 11:1653826-1653848 CGTCCTTGCCCTCAGCATTCAGG - Intergenic
1078063697 11:8064256-8064278 CATGCTTGTCCCCACCTTGATGG + Intronic
1082692075 11:56318438-56318460 CATGATTGTCCTCACCAAGTTGG + Exonic
1083707675 11:64527403-64527425 CATCCATGTGCTCACCAGCCTGG - Intergenic
1089325000 11:117650961-117650983 CATCCCTGTCCTCTCCCTGGAGG - Intronic
1089984773 11:122803051-122803073 CATCCTTCTGCTCACACTGCTGG - Intronic
1090637312 11:128697966-128697988 CACGCTTCTCCTCACCATCCTGG - Intronic
1090677595 11:129015424-129015446 TATCCATGTCCTCATCATGCAGG + Intronic
1092064111 12:5575262-5575284 GAGCCTTGTCCTCACCATCAAGG - Intronic
1093752221 12:22812759-22812781 CATCTGTGTCCTCACCAGACTGG + Intergenic
1096211271 12:49767798-49767820 CTTCCTTGCACTCCCCATGCTGG - Intergenic
1096477537 12:51917557-51917579 CATCCTTGTCCCCAAGAAGCAGG - Intronic
1096937281 12:55295085-55295107 CATCATCATCCTCACCCTGCTGG - Exonic
1096960729 12:55574540-55574562 TATCCTCATCCTCACCTTGCTGG + Exonic
1098293466 12:68980885-68980907 CATCTTTGTCAGGACCATGCAGG - Intergenic
1098893039 12:76029926-76029948 CATACTTTTCATCACGATGCAGG - Exonic
1100336801 12:93639236-93639258 CATCCTTGTCCTCATCACCCAGG + Intergenic
1102138048 12:110591738-110591760 CAGCCTTGACCTCAGCAGGCAGG + Intergenic
1103436667 12:120932098-120932120 GATACTTGCCCTCACCAAGCTGG - Intergenic
1104013248 12:124946926-124946948 CATCTGTGCCCTCACCATGGAGG + Exonic
1105686660 13:22789933-22789955 GATTCCTGTCCTCACCATGCTGG - Intergenic
1112412455 13:99176229-99176251 GAGCCTTTTCCACACCATGCAGG - Intergenic
1115449210 14:33527000-33527022 CATCCTTGTCCTTAGGAAGCTGG + Intronic
1119419932 14:74502549-74502571 CTTCCCAGTCCTCACCCTGCTGG + Intronic
1119607609 14:76034335-76034357 CTTCCTTGTCCCCATCATGAGGG + Intronic
1121911232 14:97794338-97794360 CTTCCTTGCTCCCACCATGCTGG + Intergenic
1122575353 14:102738466-102738488 CACCCATGTGCTCACCAGGCAGG - Intergenic
1123010966 14:105349314-105349336 CACCCATGTCCTCAGCATACAGG + Intronic
1124234014 15:27971094-27971116 TTTCCGTGTTCTCACCATGCCGG - Intronic
1126088467 15:45030809-45030831 CTCCCCTGTCCTCACCAGGCTGG - Intronic
1127659694 15:61088891-61088913 CACCCATGTCATCACCATGCAGG + Intronic
1128577241 15:68784403-68784425 CATCCTCCTCCTCATCATCCAGG + Exonic
1128816994 15:70617638-70617660 CATCCATGTAGTCACCATCCAGG + Intergenic
1133154538 16:3863799-3863821 CACCCTTGTCCCCACCCTTCAGG - Intronic
1135126833 16:19817587-19817609 CATCCATTTCCTCATCATTCTGG - Intronic
1135222268 16:20623402-20623424 CACCCTCGTCCTCACCATAGTGG + Exonic
1138311287 16:56025772-56025794 CTCCCTAGTCCTCACCATTCAGG + Intergenic
1141182461 16:81763543-81763565 CTACCCTGACCTCACCATGCTGG - Intronic
1141645944 16:85367661-85367683 CATGCTTACCCTCACCATGAAGG + Intergenic
1203116079 16_KI270728v1_random:1491847-1491869 CCTCCTGGTGCTCACCCTGCAGG - Intergenic
1144948979 17:18983957-18983979 CATCCTTGGCCACTCAATGCTGG + Intronic
1148100983 17:45091263-45091285 CTTACTGGCCCTCACCATGCCGG + Intronic
1148213987 17:45824601-45824623 CTTCCTTGTCCTAACCCTGCTGG - Intronic
1148325293 17:46779730-46779752 CTGCCTTGTGCTCACCATGCAGG - Intronic
1149566143 17:57642062-57642084 CATCATTGGCCTGACCATCCAGG - Intronic
1150073051 17:62168874-62168896 CTTCTGTGTCCTCACCATGGTGG - Intergenic
1151084357 17:71363799-71363821 CATCCTTGTTTTCCCCAAGCAGG - Intergenic
1152797254 17:82314530-82314552 CAGCCTTGTGCTCAGCTTGCTGG + Intergenic
1154005841 18:10526513-10526535 CATCCTTGGCCTCTACCTGCTGG + Intronic
1156193904 18:34751364-34751386 CTTCCTTCCACTCACCATGCTGG + Intronic
1162515095 19:11142843-11142865 CATCCTCGTCCCCCCCAGGCAGG - Intronic
1162742237 19:12779841-12779863 CATCCTTGTCCGTAACATCCAGG + Intronic
1162947468 19:14052476-14052498 CATCCGTGTCTTCCCCATGGGGG - Exonic
1163060315 19:14755877-14755899 CAACCTTGGCCTCGCCCTGCAGG - Exonic
1168590749 19:57632772-57632794 CATCCTTGTGTTCTTCATGCTGG + Intronic
925051119 2:816439-816461 CACCCTCCTCCTCACCATGCAGG - Intergenic
925585556 2:5460846-5460868 CATCCTTGTCCTCACTGCTCTGG - Intergenic
927060309 2:19412456-19412478 CATCCCTGCCCTCACCAAGCTGG - Intergenic
928432022 2:31228050-31228072 CTTCCTGCTCCTCACCACGCGGG - Intronic
929267756 2:39938165-39938187 CAGCCTTGTCCACACCAAGAAGG - Intergenic
935468953 2:103433888-103433910 TATGATTGTCCTCACCATGGAGG + Intergenic
935814832 2:106837917-106837939 CCTCCCTGCCCTCTCCATGCAGG - Intronic
936924341 2:117721383-117721405 CATCCTTTTAATCACCATCCAGG - Intergenic
940496214 2:154432426-154432448 CCTCCTTTTCCTCCTCATGCTGG - Intronic
940737941 2:157474232-157474254 CATACTTGTCCTCAGCATAATGG - Intronic
940876255 2:158900544-158900566 CTTCCTTGTCCAGACCATCCCGG + Intergenic
945804898 2:214478634-214478656 CATGCGTGTCCTCACCCTCCAGG + Intronic
946181620 2:217952529-217952551 TGTCCATGTCCTCACCAGGCTGG - Intronic
947643612 2:231721876-231721898 CAGCCTTGTCCTGAAGATGCTGG + Intergenic
948831218 2:240599180-240599202 CATCCTCATCCTCACCATCTCGG - Intronic
1168980275 20:1997950-1997972 CCTCTTTGTCCTCACAATCCAGG + Intergenic
1169130554 20:3164501-3164523 CCTTCTTCTCCTCGCCATGCTGG + Exonic
1170538233 20:17362888-17362910 TGTCCTTGTCCTCACCATGTGGG - Intronic
1170885951 20:20340060-20340082 GAGCCCTGCCCTCACCATGCAGG + Intronic
1172024300 20:31937483-31937505 CTTCCATGTCCACAACATGCAGG - Exonic
1172776369 20:37409543-37409565 CATCCTGATCCCCACCATGCAGG + Intergenic
1173522423 20:43709822-43709844 CATCCCTCTCCCCACCCTGCAGG - Intronic
1173581965 20:44153523-44153545 CCTCCATCTCCTCCCCATGCTGG - Intronic
1173592479 20:44235612-44235634 AATCCTGGTCCTCACACTGCAGG - Intergenic
1174498738 20:50968546-50968568 CATCCCTGGCCTCTCCCTGCTGG - Intergenic
1174796272 20:53525131-53525153 CTTCCGTGACGTCACCATGCTGG + Intergenic
1175241463 20:57552606-57552628 CAGCCATGTCCTCACCCTGCTGG + Intergenic
1176047646 20:63101078-63101100 CATCTCTGTTCTCACCGTGCAGG - Intergenic
1177751219 21:25286313-25286335 CATCCTTGTAACCACCATCCAGG - Intergenic
1178371367 21:32030187-32030209 CATCCAGGTCCTCTCCATTCGGG + Intronic
1179239640 21:39578745-39578767 CATCCTTCCTCTCAACATGCAGG - Intronic
1180143297 21:45906119-45906141 CATCATTGTCCTCCCCATTGAGG + Intronic
1182933844 22:34201230-34201252 CAGCCATGTCCTCACCACACTGG - Intergenic
1184654232 22:45933100-45933122 CATCCCAGTCCTCACCCTGATGG - Intronic
1185017099 22:48351220-48351242 CCTCCTGGTCCACGCCATGCTGG + Intergenic
949351402 3:3127501-3127523 CATCCTCGTTCTCCCCATACGGG - Intronic
950271600 3:11620407-11620429 CACCCTTGCCCTCACCCTGCTGG - Intronic
950521493 3:13500416-13500438 GCTCCTTGTCCCCACCAAGCTGG - Intronic
951436138 3:22666914-22666936 CATCCTTGCCCCTACCATGGAGG + Intergenic
953371343 3:42391094-42391116 CTTCTTTATCCTCACAATGCTGG - Intergenic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
954943015 3:54392594-54392616 CCTCCTGGTCCTCACCAAGCTGG + Intronic
961176658 3:124841336-124841358 CTACCTTGACCTCCCCATGCAGG + Intronic
963408258 3:144896202-144896224 CATCCTAGTCCTCCTCATACTGG + Intergenic
965075392 3:163968613-163968635 CAGCCTTGCGCTCTCCATGCTGG - Intergenic
965669115 3:171128428-171128450 AATGCTTGTTCTCACCTTGCAGG + Intronic
970263149 4:14250923-14250945 CCTCATTGTTCTCACCATGTTGG - Intergenic
973377016 4:49293602-49293624 TTTCCCTGTCCTCACCATGATGG - Intergenic
973802611 4:54493938-54493960 CTTCCTTCTCCTCACCAAGAAGG + Intergenic
976412604 4:84733451-84733473 CATCTTTTTCCTCATCCTGCAGG + Exonic
977124932 4:93153480-93153502 CATCCTTTTCCTAAGCATGGTGG + Intronic
977791951 4:101115265-101115287 CCTCTTTGTCCTCAATATGCTGG - Intronic
978414261 4:108458963-108458985 CATCCTTCTACACTCCATGCTGG - Intergenic
979029876 4:115629824-115629846 CACCCTTGTTCTCTCCATGCAGG + Intergenic
980135797 4:128857491-128857513 CATCCTGCTCCCCACCACGCAGG - Intronic
980822742 4:138038344-138038366 CATTCCTGTCCTCTCCATACTGG + Intergenic
988448664 5:31317386-31317408 CATCCTTGTCAACAGCATGCAGG - Exonic
988919767 5:35929536-35929558 CCACCTTGGCCTCACAATGCTGG + Intronic
991533123 5:67637334-67637356 CATCCTAGTCATCTCTATGCTGG - Intergenic
997213999 5:132095520-132095542 CACCCTTGTCCTCACTGTGGTGG - Intergenic
997953398 5:138259671-138259693 CACCCTGGTCCTCAGCATTCTGG - Intronic
998204725 5:140150296-140150318 GATCCTTGTTCTCACCTTCCTGG + Intergenic
1002051915 5:176576146-176576168 CATCGATGACCTCACCATGGTGG + Exonic
1002386936 5:178875405-178875427 CCTCCTGCTCCTCACCAGGCAGG - Intronic
1003859485 6:10309029-10309051 CATTCTCTTCCTCTCCATGCTGG - Intergenic
1004015724 6:11730185-11730207 CATCCTTGTTGTCAACATGCGGG - Intronic
1006412472 6:33882431-33882453 CATCCAGGTGCTCCCCATGCTGG - Intergenic
1007434617 6:41800113-41800135 CTTCCATGGCCACACCATGCAGG - Intronic
1007609791 6:43142052-43142074 CATCCTGGACCCCACCAAGCTGG + Exonic
1007653032 6:43434841-43434863 CTTCCTGGTCCTCACCTTGGTGG - Exonic
1009416537 6:63421841-63421863 CATTCTTGTCCTCACAGTTCTGG + Intergenic
1013284819 6:108672124-108672146 CATCTTTGTCTTCCCAATGCCGG + Intronic
1016941081 6:149483100-149483122 CAACTTTCTCCTCACCATGGTGG - Intronic
1017898408 6:158701088-158701110 CATGACTGTCCTCACCAGGCTGG - Intronic
1018659126 6:166068695-166068717 CATTCTTGTTTTCACAATGCAGG - Intergenic
1019298886 7:293208-293230 CATACGTGTACACACCATGCTGG - Intergenic
1020269101 7:6581774-6581796 CCTTCTTTCCCTCACCATGCTGG - Intronic
1022105741 7:27195894-27195916 CTTCCTGGTCCTCACCCTCCAGG - Exonic
1023867798 7:44247054-44247076 CTTCCTTGTACACAGCATGCAGG + Intronic
1024342960 7:48285560-48285582 CATCCCTGACCTAACCTTGCAGG + Intronic
1029249477 7:99225787-99225809 CATCCTTTTCCACCCCATCCTGG + Intergenic
1029859288 7:103552103-103552125 CATCCTTCTCCTCCCCACCCTGG + Intronic
1030074569 7:105725319-105725341 CATCTTTGCACTCCCCATGCCGG + Intronic
1030374943 7:108744485-108744507 CCTCCTTTTCATCACCAGGCAGG - Intergenic
1037936001 8:22915414-22915436 CATCCCTCACCTCACCATCCTGG + Intronic
1039285986 8:36041345-36041367 CATCCTTGTTTTAACCATACAGG - Intergenic
1039481321 8:37875452-37875474 CATCCTTGTCCTCTACCTGCTGG - Intronic
1040681681 8:49818386-49818408 CACCCAAGTCCTGACCATGCTGG + Intergenic
1041349603 8:56935345-56935367 CATCTTTCTCCTCACCTTACTGG - Intergenic
1046944254 8:119959776-119959798 CCTCCTTGGCCTCAAAATGCTGG + Intronic
1047175072 8:122532851-122532873 CCTCCTTGTTCTCACCACCCTGG - Intergenic
1048845693 8:138602240-138602262 GTCCCTTGTCCTCAGCATGCAGG - Intronic
1050453334 9:5807332-5807354 CCTCCTTGTCTTCACCACACTGG + Intronic
1056809013 9:89750022-89750044 CCTCCTTGTCCTCAGCACACTGG - Intergenic
1061394624 9:130337249-130337271 CATCGTTGTCCTCCCCAGTCTGG - Intronic
1062312540 9:135946790-135946812 CATCACTGTCCTCCCCAGGCAGG + Intronic
1062561525 9:137144307-137144329 CACCCCTGTCCCCACCATCCTGG - Intronic
1190220835 X:48511499-48511521 CATCCTTATCCTCACACTGTTGG + Intronic
1192612603 X:72582484-72582506 CATCCTTGTCCTCACCATGCTGG - Exonic
1194201530 X:90958242-90958264 CACACTTGTCCTCACTGTGCAGG + Intergenic
1195746068 X:108119776-108119798 CCTCCTTCTCCTCACCATGCTGG + Intronic
1196534719 X:116829623-116829645 CTTCCTTCTCCTCAGCTTGCAGG + Intergenic