ID: 1192617004

View in Genome Browser
Species Human (GRCh38)
Location X:72635931-72635953
Sequence ATTTAGTAGCTGAATAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 469}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192617001_1192617004 2 Left 1192617001 X:72635906-72635928 CCTTCCTCCAAACAAAGAAAACA 0: 1
1: 0
2: 5
3: 124
4: 1550
Right 1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG 0: 1
1: 0
2: 4
3: 46
4: 469
1192617003_1192617004 -5 Left 1192617003 X:72635913-72635935 CCAAACAAAGAAAACATAATTTA 0: 1
1: 0
2: 7
3: 104
4: 1055
Right 1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG 0: 1
1: 0
2: 4
3: 46
4: 469
1192617002_1192617004 -2 Left 1192617002 X:72635910-72635932 CCTCCAAACAAAGAAAACATAAT 0: 1
1: 0
2: 9
3: 100
4: 1175
Right 1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG 0: 1
1: 0
2: 4
3: 46
4: 469
1192617000_1192617004 3 Left 1192617000 X:72635905-72635927 CCCTTCCTCCAAACAAAGAAAAC 0: 1
1: 0
2: 3
3: 79
4: 1129
Right 1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG 0: 1
1: 0
2: 4
3: 46
4: 469

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192617004 Original CRISPR ATTTAGTAGCTGAATAAAAA AGG Intronic
901515012 1:9739471-9739493 ATTTTGTAGATTAATAAGAAGGG + Intronic
902244821 1:15113920-15113942 ATTTTGTAGCTGAGAAAAATGGG + Intronic
904670262 1:32159482-32159504 ATTAAGCAGCTCTATAAAAATGG - Exonic
905730832 1:40298462-40298484 ATTTAGAAGCTTAACAGAAAGGG - Intergenic
906225021 1:44114541-44114563 AGTTAGTAGATGAAGAAAAGGGG + Intergenic
906464115 1:46060630-46060652 ATTTATTAGCTGTATAAACTTGG - Intronic
906923093 1:50085706-50085728 ATTAGATATCTGAATAAAAATGG - Intronic
908008360 1:59749844-59749866 ATTTACTAGCTGTATAATCACGG - Intronic
908190150 1:61694560-61694582 ATCTAGTACATGAAGAAAAATGG + Intronic
908382299 1:63608335-63608357 ATTTAGGAGCTGTACAAAATGGG + Intronic
909007202 1:70290860-70290882 AATTTGTATCTAAATAAAAATGG - Intronic
909116124 1:71539345-71539367 GTTTAGTAGATTAATAGAAATGG - Intronic
909375326 1:74934739-74934761 ATTTTGTAGATTAAAAAAAAAGG - Intergenic
909421283 1:75469030-75469052 TTTTAGTAGCTGCATTAAAAAGG + Intronic
909668018 1:78157875-78157897 GTTTTGAAGCTGAAAAAAAATGG - Intergenic
910077118 1:83294710-83294732 TTTCAGTAGCTTATTAAAAATGG - Intergenic
910742165 1:90531578-90531600 ATTTAATAACTGAATAAATGGGG - Intergenic
911389244 1:97218009-97218031 ATTTACTAGCTGGATAAATTTGG - Intronic
911407999 1:97465750-97465772 CTTTATTAGCAGCATAAAAATGG + Intronic
913570379 1:120114041-120114063 ATGTATTAGCTGACTAAATAAGG - Intergenic
914051017 1:144131116-144131138 AATTATTTGCTGAATAAAAAAGG - Intergenic
914128164 1:144834327-144834349 AATTATTTGCTGAATAAAAAAGG + Intergenic
914291183 1:146275018-146275040 ATGTATTAGCTGACTAAATAAGG - Intergenic
914552227 1:148725801-148725823 ATGTATTAGCTGACTAAATAAGG - Intergenic
916449398 1:164905859-164905881 ATTTTATAGCTGAAAAAAACGGG - Intergenic
917309577 1:173664923-173664945 ATTTATTAGCTGCATAATACTGG + Intronic
917803147 1:178588629-178588651 ATGTAGAAGCTAAAAAAAAAAGG - Intergenic
918724808 1:187906683-187906705 ATTTTCTAGATTAATAAAAAAGG - Intergenic
918867026 1:189914680-189914702 ATTTTGGGGCTGAATAAAAAAGG + Intergenic
918988670 1:191667664-191667686 ATATAGTAGGTGAAGAAATATGG - Intergenic
919201133 1:194356751-194356773 AATTAGTGGGTGAATGAAAAGGG + Intergenic
919394672 1:197030437-197030459 ATTTAGTGATTGAATAAAAGTGG + Intergenic
919535604 1:198783599-198783621 ATTTAATAGCTGAAAATAGAAGG + Intergenic
919566271 1:199192934-199192956 ATTTTGTAGCTGCCTGAAAATGG + Intergenic
919575771 1:199307478-199307500 ATTAAGTAACTGAGAAAAAAAGG - Intergenic
919627761 1:199928671-199928693 CATTATTAGCTGAAGAAAAATGG + Intergenic
920585958 1:207160673-207160695 ACTGAGTAGCTGGATAAAATAGG - Intergenic
920973957 1:210768287-210768309 ATTTCATACCTGAATAAAATAGG + Intronic
921403345 1:214751372-214751394 ATTTATTATCTTAATAGAAATGG - Intergenic
921601359 1:217109980-217110002 AATTAGAAGCTAAATAAACAGGG - Intronic
921946934 1:220892384-220892406 GTTTTGTAGCTGAAAAAAATGGG + Intergenic
924244652 1:242072449-242072471 CATTATTAGCTGAAGAAAAATGG - Intergenic
1064066280 10:12184711-12184733 TTATAGTTGCTGAATAAAATTGG - Intronic
1064183652 10:13141507-13141529 ATTTAGGAACTGACTGAAAAGGG - Intergenic
1064504418 10:16013504-16013526 ATTTATTAGCAGCATGAAAACGG + Intergenic
1064909789 10:20387320-20387342 ATGCAGTAGCTTAATAAGAAAGG - Intergenic
1065653332 10:27917587-27917609 TTTTAAAAGGTGAATAAAAATGG + Intronic
1065662506 10:28020434-28020456 ATTTAGCAGATGTATAAAAATGG - Intergenic
1065713993 10:28546653-28546675 ATTTAACAGCTATATAAAAAAGG - Intronic
1066147112 10:32572258-32572280 ATATAGTAACTGAGTTAAAATGG - Intronic
1068244320 10:54343883-54343905 ATTTAATATATGAATAAAATTGG - Intronic
1068927378 10:62554377-62554399 TTTTACTGGCTGAATACAAATGG + Intronic
1070936522 10:80302275-80302297 ACTTAAGAGATGAATAAAAATGG + Intergenic
1071020568 10:81050084-81050106 ATTTAGAAGATGAATGAAAAGGG - Intergenic
1072168947 10:92841897-92841919 ATTTAGTAAATAAATAATAATGG + Intronic
1072183776 10:93014969-93014991 ATTAAGTAGCTTAATAAAGCTGG + Intronic
1074525459 10:114259731-114259753 ATTTAGTGTGTGATTAAAAAGGG - Intronic
1075986017 10:126785813-126785835 ATTTAGTATCTGGGTAAAACTGG - Intergenic
1078491946 11:11777606-11777628 ATTTAATAGATGAATATTAAGGG + Intergenic
1078558842 11:12353407-12353429 ATTTAGAAGCCAAACAAAAAAGG - Intronic
1079662333 11:23054732-23054754 ATTTTGTAGATGAAAAATAAAGG + Intergenic
1079762725 11:24351263-24351285 ATTTTGGTTCTGAATAAAAAGGG + Intergenic
1079815120 11:25046848-25046870 ATGTAAAAGCAGAATAAAAATGG + Intronic
1079966432 11:26985760-26985782 ATTTTGGAGATGAATCAAAATGG - Intergenic
1081266698 11:41032704-41032726 ATTTAGTAACTGAAAAAAGGGGG + Intronic
1081298771 11:41424868-41424890 AGATAGTAGCTGAATACAATAGG + Intronic
1082908630 11:58343553-58343575 ATGTAATACCTGAATAAAAATGG - Intergenic
1083106385 11:60362260-60362282 ATTTCAGAGCTGTATAAAAATGG - Intronic
1083121985 11:60521828-60521850 CTTTATTAGCAGCATAAAAATGG - Intronic
1086021115 11:82230985-82231007 ATTTGGTAGGTAGATAAAAAAGG - Intergenic
1086473470 11:87143197-87143219 ATTTAATAGATGGATAAATAAGG - Intronic
1086592089 11:88526758-88526780 ATCTAGTATTTGAAGAAAAATGG + Intronic
1087321493 11:96665145-96665167 ATTTAGTTTCTGAATGAAAATGG - Intergenic
1087479307 11:98679918-98679940 ATTTAGAATCTGGATGAAAAAGG - Intergenic
1087505097 11:99010680-99010702 AAGTAGCAGCTGCATAAAAAAGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1089025633 11:115266775-115266797 ATTCTGTATCTTAATAAAAAAGG + Intronic
1091345618 11:134851595-134851617 ATTTACTATCTGAAATAAAAGGG + Intergenic
1091630926 12:2160317-2160339 ACTCAGTGGCTGAATAAACATGG + Intronic
1092373763 12:7938445-7938467 ATTTAGTATCTAAAGGAAAAAGG + Intergenic
1092625040 12:10317733-10317755 CTTTAGTAGCAGCATAAGAACGG - Intergenic
1092633019 12:10405806-10405828 ATATAGTAGAAGAATATAAAAGG - Intronic
1092694849 12:11159936-11159958 ATATAGTAGCTGACTGAAAGTGG - Intronic
1093274345 12:17105627-17105649 ATCTAGGATCAGAATAAAAATGG + Intergenic
1093612436 12:21178390-21178412 ATTTATTAGCAGCATAAGAATGG + Intronic
1093658059 12:21720526-21720548 TTTTTGTTGCTGAAAAAAAATGG + Intronic
1093755657 12:22849415-22849437 ATTTAGTGGCAAAATAAATATGG - Intergenic
1093927124 12:24920039-24920061 CTTTATTAGCAGCATAAAAATGG + Intronic
1094689883 12:32758199-32758221 ATTTAGTACCTTAATACATAGGG + Intergenic
1095497841 12:42803994-42804016 ATTTAGTAGCCAAAGAAAATGGG + Intergenic
1095710300 12:45281162-45281184 ATTTACTAAATGAATAAATAAGG - Intronic
1095794741 12:46206012-46206034 AATCAGAAACTGAATAAAAATGG - Intronic
1095828147 12:46552174-46552196 ATTTAATTGATGAATAAAAGTGG + Intergenic
1096685310 12:53284562-53284584 AGTCAGTATCTGATTAAAAAGGG - Intronic
1097282979 12:57856710-57856732 AATTAGAAGCTGAAAAATAAAGG - Intergenic
1097729234 12:63108737-63108759 ATTTGGTAGCAGAGTGAAAAAGG + Intergenic
1097924613 12:65113428-65113450 ATTTAGAATCAGAATAAATAGGG + Intronic
1098305622 12:69099704-69099726 TTTTAGTAGCTGAAAAACAACGG - Intergenic
1098371306 12:69763107-69763129 CATTATTAGCTGAAGAAAAATGG + Intronic
1099359290 12:81679560-81679582 ATGTAGAAGATGAATGAAAAGGG + Intronic
1099521269 12:83666544-83666566 ATTTATTGGGTGAATACAAAAGG + Intergenic
1099565489 12:84239449-84239471 CATTATTAGCTGAAGAAAAATGG - Intergenic
1099648515 12:85393237-85393259 TTTAAGTAATTGAATAAAAATGG - Intergenic
1099738313 12:86599653-86599675 ATTTTACAGCTGAAAAAAAATGG + Intronic
1100159960 12:91846550-91846572 ATTTAGTGGGGGAAAAAAAATGG + Intergenic
1100459199 12:94781909-94781931 ATTTATCAGCTGAAAAAAATTGG + Intergenic
1101012772 12:100468115-100468137 AATTAATTGCTGAATAAAATAGG - Intergenic
1101216068 12:102584540-102584562 ATTAAGTAACTGAACAAATAAGG - Intergenic
1101484821 12:105145235-105145257 ATTTAGTATCTTAGGAAAAATGG + Intronic
1103309595 12:119994056-119994078 ATTTAATTCCTGAAGAAAAAAGG - Intronic
1104888206 12:132124483-132124505 TTTGAGTAGGTGATTAAAAATGG - Intronic
1106190480 13:27448659-27448681 ATTTAATAGCTAAAGAAATAAGG - Intronic
1106677429 13:31975866-31975888 CATTAGTAACTGAAGAAAAATGG - Intergenic
1106911808 13:34471124-34471146 ATATAGGAGCAGAAAAAAAAGGG + Intergenic
1108185607 13:47885433-47885455 ATTTACTTGCTGAATATAAGAGG - Intergenic
1108551257 13:51547254-51547276 ATTTAATAGATGCATAAAGATGG - Intergenic
1108817118 13:54305469-54305491 CTCTAGTAGCTGAAGACAAAGGG + Intergenic
1109044113 13:57385939-57385961 TTTTGGAAGCTTAATAAAAATGG - Intergenic
1109240546 13:59882008-59882030 ATTTTGTTGTTAAATAAAAAGGG - Intronic
1109508390 13:63336827-63336849 CCCTAGTAGCTGAAGAAAAAGGG - Intergenic
1109595050 13:64540989-64541011 TTTTAGAAGATAAATAAAAATGG - Intergenic
1109637154 13:65136140-65136162 ATCTAGTAGGTGAAGAACAATGG - Intergenic
1110103414 13:71638030-71638052 ATTTAATAGTTAAATAAAATGGG + Intronic
1110559595 13:76896515-76896537 AGTTAGCAGCTGTATAAAAAGGG + Intergenic
1111201724 13:84947181-84947203 ATTTATTAAATGAATAGAAAAGG - Intergenic
1112289101 13:98129168-98129190 CTTTATTAGCAGCATAAAAATGG + Intergenic
1112385634 13:98937166-98937188 ATTTATTAGCGGAATGGAAATGG - Intronic
1112708020 13:102094633-102094655 AGTTAGCAGCTGTATAAAAAGGG - Intronic
1113128056 13:107002336-107002358 ATTTATAAGCTGAATAAACTTGG - Intergenic
1113964199 13:114143261-114143283 ATTTAGAAGCTGAGTACACAAGG - Intergenic
1114735856 14:25043221-25043243 GTTTACTACCTGAATTAAAAGGG - Intronic
1115830840 14:37338707-37338729 ATTTGGTACCTTGATAAAAATGG - Intronic
1116122529 14:40738318-40738340 ATTGAGTAGAGGAATAATAAAGG - Intergenic
1116159957 14:41255191-41255213 ATTTAGTTTCTGAATATAACTGG - Intergenic
1116381486 14:44274696-44274718 GTTTAGAAGATAAATAAAAACGG + Intergenic
1117283870 14:54267049-54267071 CTTTATTAGCAGCATAAAAATGG + Intergenic
1117924468 14:60763442-60763464 ATTTTATAGATGAATAAAATAGG + Intronic
1119069946 14:71572432-71572454 ATTTAGTAACTGCCTAAGAAGGG - Intronic
1120369991 14:83621088-83621110 ATTTAGAATCAGAATAAAATAGG - Intergenic
1120591697 14:86382083-86382105 ATACAGTAGCTGAATGGAAATGG - Intergenic
1121159438 14:91723480-91723502 ATTTTGTGTCTAAATAAAAAAGG + Intronic
1122207799 14:100156872-100156894 ATTTATTAGCTGAAAACAACAGG + Intronic
1122593671 14:102873510-102873532 CATAAGTAGCTGAAGAAAAATGG + Intronic
1123952545 15:25295922-25295944 ATATAGTAGATGAACAACAATGG + Intergenic
1125493737 15:40169973-40169995 ACTTATTACATGAATAAAAATGG + Intronic
1125708774 15:41766574-41766596 ATTTAGTTGTTGATTAAGAAAGG - Exonic
1126540594 15:49818116-49818138 ATTTATTAGCTGTATGAAACTGG + Intergenic
1126999776 15:54488735-54488757 TTTTACTACCAGAATAAAAATGG - Intronic
1127471312 15:59293125-59293147 TTTTCCTAGCAGAATAAAAAGGG - Intronic
1127636673 15:60877523-60877545 ATTTAGTCTGTGAGTAAAAATGG + Intronic
1129836021 15:78706482-78706504 CTTTAGCAGCAGAATAAAACTGG + Intronic
1130212482 15:81937814-81937836 ATTTGGCAACTGAATAAACAGGG - Intergenic
1130511323 15:84592157-84592179 CTTTAGCAGCAGAATAAAACTGG - Intergenic
1130881689 15:88060967-88060989 TTTTAATAGTTGAAAAAAAAAGG - Intronic
1131256598 15:90866823-90866845 ATTTCTTTGCTGAATAAATAAGG - Intergenic
1134420651 16:14085142-14085164 ATTTTCTATCTGAAGAAAAAAGG - Intronic
1134421379 16:14093417-14093439 ATTAAGTAAATAAATAAAAATGG - Intronic
1135796231 16:25445472-25445494 ATTTAGTGGCTCAGCAAAAACGG + Intergenic
1138101806 16:54257945-54257967 ATTTAGCAGCAGTATGAAAACGG + Intronic
1140130278 16:72154660-72154682 ATTCAGTAGAAGAAAAAAAATGG + Intronic
1140281635 16:73559993-73560015 ATTTAATAGAAGAATTAAAAGGG + Intergenic
1140282575 16:73568149-73568171 ATTTAGTAACTTAAAAACAAAGG - Intergenic
1141317696 16:82977675-82977697 CTTTATTAGCAGCATAAAAATGG + Intronic
1143161435 17:4874349-4874371 ATTTAGTGGTTGGATAATAACGG + Intronic
1143809287 17:9457741-9457763 ACTTTGTAGAGGAATAAAAAAGG + Intronic
1145294850 17:21580484-21580506 AATTATGTGCTGAATAAAAAAGG - Intergenic
1147137557 17:38443032-38443054 ATTTTATAGCTGAAGAAATAAGG + Intronic
1148903564 17:50896929-50896951 ATTTAGCAGCTGAATAATCACGG + Intergenic
1149307187 17:55359475-55359497 TATTATTAACTGAATAAAAATGG + Intergenic
1150742700 17:67792271-67792293 CATTATTAGCTGAAGAAAAATGG - Intergenic
1152935101 17:83132146-83132168 ATTTAGAAGTTAAATAAAACTGG - Intergenic
1153044389 18:842546-842568 ATTTAGCAAATGAATAAAAGGGG + Intergenic
1153351482 18:4085146-4085168 ATTAAGTGGGTAAATAAAAAAGG + Intronic
1153526765 18:6003193-6003215 ATATAGTATCTCTATAAAAAAGG + Intronic
1153733295 18:8037521-8037543 ATTTAGTACCTCAAGAGAAATGG - Intronic
1155767181 18:29650259-29650281 TTTGAAAAGCTGAATAAAAATGG + Intergenic
1155778526 18:29799462-29799484 ATTTAATAACTGATTAAACAGGG + Intergenic
1156945059 18:42819716-42819738 ATTTAACAGGTGAATAAAATGGG - Intronic
1157930193 18:51813106-51813128 ATTTTGTATCTGCAGAAAAATGG - Intergenic
1158270077 18:55703324-55703346 CATTATTAGCTGAAGAAAAATGG - Intergenic
1159289829 18:66402264-66402286 ATATAGGAGCGGAATGAAAATGG - Intergenic
1159405354 18:67995079-67995101 ATTTACTAGCTCTATTAAAAGGG + Intergenic
1159495634 18:69199941-69199963 ATGTAGTAGAGGAAAAAAAAGGG - Intergenic
1160249344 18:77187481-77187503 ATTTAGTGGCTGGTGAAAAAGGG + Intergenic
1160314023 18:77823413-77823435 ATTTCTGAGTTGAATAAAAAGGG - Intergenic
1160882482 19:1327534-1327556 TTTTGGTAGCTACATAAAAATGG + Intergenic
1162597882 19:11642970-11642992 CTTTATTAGCTGAATGAGAACGG + Intergenic
1163285605 19:16345302-16345324 ATTTTATAGATGAAGAAAAATGG + Intergenic
1164212677 19:23113860-23113882 ATTTAGAAGATGACCAAAAAAGG + Intronic
1166222473 19:41374615-41374637 ATTTTGTAGGTGAAGAAATAGGG + Intronic
1167750663 19:51378034-51378056 CTTGAGTAGCTGGATAAAAATGG + Intergenic
1202690425 1_KI270712v1_random:83754-83776 AATTATTTGCTGAATAAAAAAGG - Intergenic
925959140 2:8998870-8998892 ATTTACCATTTGAATAAAAAAGG - Intronic
926405901 2:12552271-12552293 CTTTGGTGGCTGAATAAAAGCGG + Intergenic
926516509 2:13853128-13853150 CTTTATTAGCTGCATGAAAATGG - Intergenic
927072504 2:19545533-19545555 CTTTAATAGCAGCATAAAAATGG - Intergenic
927251731 2:21001311-21001333 TTTAAGTAACAGAATAAAAATGG - Intergenic
927266431 2:21157725-21157747 ATTTATTAACTGAAGAAAAATGG - Intergenic
928817248 2:35312875-35312897 AGTGAGTAGCTGAATAGTAATGG - Intergenic
929335447 2:40738541-40738563 ATTGAGTAGCTGAGGAAGAAGGG - Intergenic
929401962 2:41593908-41593930 ATTTAAGAATTGAATAAAAAAGG - Intergenic
930959843 2:57248016-57248038 ATTAATTAGCTGAATATAATTGG - Intergenic
931190217 2:59992955-59992977 ATTGAGAAGATAAATAAAAATGG + Intergenic
931389613 2:61830153-61830175 TTTTAGTAGGGGAATGAAAATGG + Intronic
931650930 2:64468147-64468169 ATTTAGAAGCTGCCTAAAAGAGG - Intergenic
932248095 2:70214481-70214503 ATTTAATAGCAGAATCAAATTGG - Exonic
932821026 2:74900790-74900812 AGTTAGTAGCTGAATGGCAACGG - Intergenic
932856917 2:75243673-75243695 ATTTTGTGGATGAATTAAAAGGG - Intergenic
933466888 2:82663091-82663113 AATTATTAACTGAATAAAAATGG + Intergenic
934032551 2:88061379-88061401 TTTTTGTATCTGAATAAAGAAGG - Intergenic
934462591 2:94227566-94227588 AATTATTTGCTGAATAAAAAAGG + Intergenic
934606817 2:95701553-95701575 ATCCAGTAGCTGAACAATAATGG + Intergenic
936583989 2:113735931-113735953 ATTTAGGAGGAGAACAAAAAAGG - Intronic
936959095 2:118054917-118054939 TTTAAGTGGCTGAACAAAAATGG + Intergenic
937785803 2:125896081-125896103 ATGTATTCACTGAATAAAAAAGG - Intergenic
938622839 2:133074722-133074744 GCTTAGTAGCAGAATAGAAATGG + Intronic
938811890 2:134861597-134861619 ACTTAGGAGCTGAATTAAAGGGG + Intronic
938863242 2:135391994-135392016 ATTAAGTAGCAGAAAAACAAGGG + Intronic
939147659 2:138435502-138435524 GTTTAAGAGCTGAATAACAAAGG - Intergenic
939230465 2:139418674-139418696 TTTTAGTAGCTTTTTAAAAAAGG + Intergenic
939543981 2:143529688-143529710 ATTTGGCAGATGGATAAAAAGGG - Intronic
939625038 2:144466637-144466659 ATTAATAAGCTGAATAATAAGGG + Intronic
939769390 2:146297134-146297156 ACTTACTAGTTGCATAAAAATGG + Intergenic
939854094 2:147336291-147336313 ATCTAATACATGAATAAAAATGG + Intergenic
940225246 2:151394260-151394282 ATCTAGTATCTGAAGTAAAAGGG - Intergenic
940229485 2:151434935-151434957 AATTAAAAACTGAATAAAAATGG - Intronic
940501849 2:154503620-154503642 CTTTATCAGCAGAATAAAAAGGG + Intergenic
940610637 2:155986985-155987007 TTTTAGGAGCTGAATAAAACTGG - Intergenic
940794957 2:158068104-158068126 ATTTAGTTACTTAATGAAAATGG + Intronic
941355474 2:164486124-164486146 AATTAGAAGCTTAACAAAAAAGG - Intergenic
941501476 2:166283874-166283896 ATTTATTAGCTGAGTAAATTGGG + Intronic
942039693 2:172047409-172047431 ATTTAGTAACAGAATAAAAAAGG + Intronic
942082372 2:172412834-172412856 AAAAAGTAGATGAATAAAAATGG - Intergenic
942206825 2:173627405-173627427 ATTTATTAGGTGAATAAAAGGGG + Intergenic
942698156 2:178670159-178670181 ACATAGTAAGTGAATAAAAAAGG + Intronic
943023608 2:182602687-182602709 ATTTGGAAGCAGAATAAAATTGG + Intergenic
943044219 2:182839356-182839378 ATTTACTTCTTGAATAAAAATGG + Intronic
943954746 2:194174627-194174649 ATTTAGTAGCTAAATAATTATGG - Intergenic
944005495 2:194899740-194899762 TTTTAGTAGATGAATAAAATTGG + Intergenic
944344860 2:198650785-198650807 ATTTTGTAGCTAAATGCAAATGG + Intergenic
944373898 2:199017627-199017649 ATTTAGTAAGTGGGTAAAAAGGG + Intergenic
946901112 2:224372726-224372748 ATTTAGTAGGTGCAAAACAAGGG + Intergenic
947961852 2:234246502-234246524 ACTGAGTAGCTTGATAAAAAAGG + Intergenic
1169780043 20:9299964-9299986 ATTTAATGGCTTAATAAAAATGG + Intronic
1171378236 20:24710199-24710221 CTTTAGTAAATGAATTAAAATGG + Intergenic
1173663428 20:44749885-44749907 ATTCAGTTGCTGAAAAAAATTGG + Intronic
1173876743 20:46377356-46377378 TTTTAGTAGCAGCATGAAAAAGG - Intronic
1176312476 21:5159981-5160003 CATTATTAGCTGAATAAAAATGG + Intergenic
1177133180 21:17282027-17282049 TTTTATTAGCAGAATGAAAATGG + Intergenic
1177449255 21:21244171-21244193 TTTTAGGAGATGAATAAAAGAGG - Intronic
1177483138 21:21720198-21720220 ATTTGGGAGCTTAATAAAAGTGG - Intergenic
1177644670 21:23886531-23886553 ATTTAATAGTTAATTAAAAATGG - Intergenic
1177928615 21:27250628-27250650 AATTAGAAGCAGAATAAATAGGG + Intergenic
1178006189 21:28222658-28222680 ATTGAGAAACTGAATAAAACAGG + Intergenic
1178061896 21:28861858-28861880 ATTTGGTAGCTGATTACTAAAGG - Intergenic
1178145159 21:29731008-29731030 CATTACTAGCTGAAGAAAAATGG + Intronic
1179844572 21:44102049-44102071 CATTATTAGCTGAATAAAAATGG - Intronic
1182089652 22:27585383-27585405 ATTTTGTAGATGAGTAAAAGGGG - Intergenic
1182814959 22:33154191-33154213 CTTCAGTAGCTTAATAAAAGAGG - Intergenic
949677660 3:6475545-6475567 TATTAGAAGCTGAATAAATATGG + Intergenic
951276916 3:20698841-20698863 TTTCAGTAGCTGCATTAAAAAGG - Intergenic
951417128 3:22438549-22438571 ATTTAGAAGCTTTCTAAAAAGGG + Intergenic
953149011 3:40307201-40307223 CTTTAGTAGCTACATTAAAAAGG + Intergenic
953627373 3:44581813-44581835 ATTTAGAAGCTGAATGACCAGGG - Intronic
953812259 3:46123456-46123478 ATTTACTAACTAAAGAAAAATGG + Intergenic
954567341 3:51609663-51609685 ATTCAGTAGTTGAGAAAAAAAGG - Intronic
954675847 3:52315031-52315053 ATTTCTTTGATGAATAAAAATGG - Intergenic
954976858 3:54704219-54704241 ATTTAGAATCTCAATAAAAAAGG + Intronic
955106442 3:55903098-55903120 GTTTAATAGGTGAATATAAATGG - Intronic
955179641 3:56655241-56655263 ACTAAGAAGTTGAATAAAAATGG - Intronic
955185001 3:56706622-56706644 ATATAGTATCAGAATGAAAATGG + Intergenic
955295543 3:57732026-57732048 ATTTAATTGGTGAATAGAAATGG + Intergenic
955970838 3:64436758-64436780 CTTTATTAGCAGCATAAAAATGG + Intronic
956060752 3:65345696-65345718 ATTTAGCAGTTAAAAAAAAAAGG + Intergenic
956505284 3:69931407-69931429 ATTTAGTAGCCTCAGAAAAAAGG - Intronic
956662384 3:71611992-71612014 ACTTAGAAGCTTAATAAAGATGG + Intergenic
956718309 3:72097759-72097781 ATTTAATAGCTTTATAGAAATGG + Intergenic
956993881 3:74801125-74801147 ATTGAGTAGATTAGTAAAAAAGG + Intergenic
957558725 3:81794253-81794275 ATTTCCTATCTGAAGAAAAAAGG + Intergenic
958074602 3:88659173-88659195 AATTAGTAGCTGTGTATAAAAGG + Intergenic
958263566 3:91410268-91410290 ACTTAGTCCCTGAGTAAAAAGGG - Intergenic
958884558 3:99711286-99711308 ATTCAGTAGTTACATAAAAAGGG + Intronic
959501289 3:107108413-107108435 CTTTATTAGCTGCATGAAAATGG + Intergenic
959715716 3:109431030-109431052 CCTTAGTAGCTGAAGACAAAGGG - Intergenic
960351726 3:116602163-116602185 ATTTAGTAGCTGCATAACACTGG - Intronic
960905750 3:122599420-122599442 TTTTATTAGCTGGATAACAATGG + Intronic
961587133 3:127940728-127940750 AATTAGAGGCTGAAAAAAAAAGG + Intronic
961600059 3:128053286-128053308 CTTTAGCAGCTGGATACAAAGGG - Intronic
962077350 3:132096602-132096624 ATGTCATATCTGAATAAAAAAGG - Intronic
962503738 3:136024287-136024309 TTAAAGTAGCTGAATAAAACTGG - Intronic
962714070 3:138112217-138112239 ATTTAGTAGCTGAGTGAGCAGGG - Intronic
962720769 3:138172755-138172777 ATTTACTTGCTGAAGAAAACAGG - Intronic
963462190 3:145629857-145629879 ATTTCTAAGCTCAATAAAAAAGG - Intergenic
963621857 3:147619536-147619558 ATTTTCTATATGAATAAAAATGG - Intergenic
963784443 3:149519610-149519632 ATTTTGTAGCTGATGACAAAAGG - Exonic
964008851 3:151865364-151865386 ATTTAGCAAATCAATAAAAAGGG + Intergenic
964589627 3:158345962-158345984 ATATAGTACCCAAATAAAAAAGG + Intronic
964601234 3:158503462-158503484 CTTTGGTAGCTGAAGACAAAGGG - Intronic
964887166 3:161497577-161497599 AATTAGTGGCTGATTTAAAAAGG + Intronic
965009735 3:163072788-163072810 ACTATGTAACTGAATAAAAATGG - Intergenic
965099311 3:164276674-164276696 TTTTAGTATCTTAAGAAAAAGGG + Intergenic
965235230 3:166109999-166110021 ATTTACTAGCTGCATACCAAAGG + Intergenic
965273595 3:166651773-166651795 TTTTAAAAGCTTAATAAAAATGG - Intergenic
965413452 3:168362338-168362360 ATTTGGTAGTAGAATAAAAGTGG + Intergenic
965678176 3:171221747-171221769 AGTATGTAGCTGAAAAAAAATGG - Intronic
965788888 3:172366405-172366427 ATTTAGTTCTTGAGTAAAAAGGG + Intronic
966619651 3:181950329-181950351 AGTTTGTAACTGCATAAAAATGG - Intergenic
969081661 4:4623532-4623554 CTTTAGTAGCAGTGTAAAAATGG + Intergenic
969841127 4:9882868-9882890 ATTTATTAGCAGAACAATAAGGG + Intronic
970143366 4:13007401-13007423 ATTTGCTTGCTGAATAAGAATGG + Intergenic
970224295 4:13841254-13841276 ATTTTGTAGCTAGATAATAATGG - Intergenic
970840794 4:20465933-20465955 AGTGTGTAGATGAATAAAAACGG - Intronic
971495852 4:27264440-27264462 ATTTATTGTCTGAATGAAAAAGG - Intergenic
971725653 4:30308266-30308288 ATTTAGTAGCTGACTAGAAGAGG - Intergenic
971862902 4:32131175-32131197 ATTTAGTAGCTTTATAGATAAGG + Intergenic
972189052 4:36568517-36568539 CTCTGGTAGCTGAAGAAAAAGGG - Intergenic
972644287 4:40953360-40953382 AATTAGAAGATGAATAAATAAGG + Intronic
973213193 4:47638727-47638749 CTTTATTAGCAGCATAAAAATGG + Intronic
973686481 4:53375784-53375806 ATTTAGTTGTTCAATCAAAATGG + Intergenic
973969702 4:56199955-56199977 ATTTAGTTTGGGAATAAAAATGG + Intronic
973988806 4:56382686-56382708 TTTTTGTAGCAGCATAAAAATGG + Intronic
974787291 4:66635564-66635586 AATTATTGGGTGAATAAAAATGG + Intergenic
974919163 4:68216148-68216170 ATTAAATAGCTGCCTAAAAACGG + Intergenic
975248993 4:72155209-72155231 ATTTACTATCTGAATAATTATGG + Intergenic
975477386 4:74839299-74839321 ATTTAGTAGTTGAATGATATGGG - Intergenic
975786891 4:77900007-77900029 ATTTTGTAGATGAATAAATAAGG - Intronic
976249708 4:83037704-83037726 TTTTAGGAGCTGAGTAACAAAGG + Intronic
976881740 4:89933478-89933500 ATTTCATAGCTGCATAAAAATGG - Intronic
976966361 4:91046254-91046276 CTATAGTAGCTGAATATTAAAGG - Intronic
977381626 4:96281650-96281672 TGTTAGCAGCTGATTAAAAATGG + Intergenic
977867604 4:102048564-102048586 ATTTGGTAGAACAATAAAAAGGG + Intronic
978015673 4:103743115-103743137 ATTATGTAGCTGTAAAAAAAGGG + Intergenic
978470693 4:109064055-109064077 ATTTAGGAGGTGAATACAACAGG + Intronic
978905468 4:114000617-114000639 AAATATTAGCTGAATCAAAAGGG + Intergenic
979168839 4:117573294-117573316 ATTTAGTCCCTGAAAAGAAAAGG - Intergenic
979643864 4:123043639-123043661 CATTAGTAATTGAATAAAAATGG + Intronic
979656854 4:123205309-123205331 ATTTAGTAGCTGTATGAACCTGG + Intronic
979840576 4:125435079-125435101 AGCTAGTAGTGGAATAAAAATGG - Intronic
980615571 4:135219062-135219084 AGTAAGTGCCTGAATAAAAAGGG - Intergenic
981435230 4:144712126-144712148 ATTTAGTAATTGAAGAGAAAGGG + Intronic
981472756 4:145155670-145155692 GTTTAGCAGCTGAAGAACAATGG - Exonic
982938493 4:161517882-161517904 CTTCAGCAGCTAAATAAAAAAGG + Intronic
983034087 4:162840636-162840658 ATTTAAAAGCTAAATAACAATGG + Intergenic
983802737 4:171955300-171955322 ATATATTATATGAATAAAAATGG - Intronic
984078300 4:175211330-175211352 ATTGAATAAATGAATAAAAATGG + Intergenic
984362450 4:178753080-178753102 ATTATGTAGATTAATAAAAAGGG - Intergenic
984536066 4:180977138-180977160 ATTTAGTATTTTAATTAAAAAGG - Intergenic
984859489 4:184224352-184224374 ATTTAGTAGCTGAGTGGTAAGGG + Intergenic
984905121 4:184619301-184619323 TTTCAGTAGCTGAATATAACTGG - Intergenic
986158597 5:5201931-5201953 ATTAAATATATGAATAAAAAAGG - Intronic
987255583 5:16147380-16147402 ATTTAATAGCTGAAAAAAACTGG + Intronic
987475133 5:18382622-18382644 GTTTAGCTTCTGAATAAAAAAGG + Intergenic
987596044 5:20000344-20000366 ACTTAGTATAAGAATAAAAAAGG + Intronic
987860220 5:23476609-23476631 ATTGAGCAGCAGAAAAAAAAGGG + Intergenic
988024850 5:25671772-25671794 AATTAGTGGATGAATAAATATGG + Intergenic
988229600 5:28457671-28457693 ATTCAACAACTGAATAAAAATGG + Intergenic
988312660 5:29581231-29581253 ATTTAGTAGATAAACAAAATGGG + Intergenic
989069820 5:37498378-37498400 ATTTAGAAGTTGAATAGAAAAGG - Intronic
989078429 5:37589533-37589555 GTTTGGTAGCTGATTAAGAAGGG - Intronic
989210493 5:38854673-38854695 ATTTGATAAATGAATAAAAATGG - Intronic
989300628 5:39888086-39888108 ATTTATTCACTGTATAAAAATGG + Intergenic
989485517 5:41986564-41986586 GTTTAGTAGATAAATACAAACGG - Intergenic
990599139 5:57339732-57339754 ATTTTGTAGCTGTAAAATAAAGG - Intergenic
991100466 5:62786463-62786485 ATTTAGTTGCTGATTCAAGAGGG - Intergenic
992123788 5:73621249-73621271 ATTTAGGAACTGAATAGAATTGG + Intergenic
992205403 5:74426146-74426168 ATTCAGTAGCAGGAGAAAAATGG + Intergenic
992681847 5:79161327-79161349 ATGTAGGAGCTGAAAAAAAAAGG + Intronic
993604356 5:89970032-89970054 ATTTATAAGTAGAATAAAAAGGG + Intergenic
994977650 5:106830487-106830509 ATTTAGCAGCTGATTAAATCTGG + Intergenic
996206203 5:120739923-120739945 ATATAATAGATGAATAAAATTGG + Intergenic
996475218 5:123910791-123910813 ATTTGGTAGGTGAATAAAATAGG + Intergenic
996795239 5:127339106-127339128 ACTGAGTAGCTGAAAAGAAATGG - Exonic
997037482 5:130210281-130210303 ACTTAATAGCTGAATAACATGGG - Intergenic
997692752 5:135837840-135837862 CTTTATTAGCAGAATAAGAATGG + Intronic
998597398 5:143547176-143547198 CATTACTAACTGAATAAAAATGG + Intergenic
998631382 5:143902508-143902530 ATTTACTAGTATAATAAAAATGG - Intergenic
998643861 5:144041455-144041477 ATTTTGTAGATGAAGAAAATGGG - Intergenic
998738167 5:145167228-145167250 ATTTAAAAGCTGAAAAAAATCGG + Intergenic
999617020 5:153435559-153435581 ATTTAATGGATGAATAAATAAGG + Intergenic
1000461897 5:161532847-161532869 ATTTAGAAGCTCAAGAAATATGG - Intronic
1001379933 5:171298296-171298318 ATTTAGTAGCTGAAAAAGAGGGG - Intronic
1001605415 5:172956557-172956579 ATTTATTAGATGGATAATAATGG - Intergenic
1001746212 5:174094452-174094474 ATTTAACAGATGAAGAAAAAGGG + Intronic
1001774554 5:174319515-174319537 ATTTAGAAGCAAAATAAAAAAGG - Intergenic
1001844961 5:174914131-174914153 CTTTAGCAGCAGAATAAAACTGG - Intergenic
1003096992 6:3149985-3150007 ATTTAGTTTCTGAATAAAAAGGG + Intronic
1003157691 6:3610046-3610068 ATTTAGGACCTGAGAAAAAAGGG + Intergenic
1004330931 6:14720467-14720489 ATTTGGTCACTGAAAAAAAAAGG + Intergenic
1004726049 6:18312246-18312268 ATTTGGGAGCTGAATGAACAGGG + Intergenic
1005367355 6:25092326-25092348 ATATAGCAGCTAAATAGAAATGG + Intergenic
1005664115 6:28033043-28033065 ATTGAATAGTTGAGTAAAAATGG + Intergenic
1005671727 6:28113117-28113139 AATTTGTAACTGAATAAAAGAGG - Intergenic
1006441774 6:34057791-34057813 ATTTAGTAGATGGATACACAGGG - Intronic
1007146327 6:39637094-39637116 ATTCAGTATATGAATATAAAAGG + Intronic
1008031798 6:46704847-46704869 CTTTAGCAGCTGAATGCAAACGG + Intronic
1008481248 6:51987828-51987850 TTTTACTAGTTGAATAAAATGGG + Intronic
1008991864 6:57612713-57612735 ACTTAGTCCCTGAGTAAAAAGGG + Intronic
1009180465 6:60511659-60511681 ACTTAGTCCCTGAGTAAAAAGGG + Intergenic
1009869388 6:69434703-69434725 ATCTAGCATCTAAATAAAAATGG + Intergenic
1010126610 6:72439963-72439985 CATTAGTAACTGAAGAAAAATGG - Intergenic
1010153099 6:72759456-72759478 ATTGGGAAGCTAAATAAAAATGG - Intronic
1010223996 6:73472310-73472332 ATTAAATAGGGGAATAAAAAAGG - Intronic
1010706871 6:79124992-79125014 CATTATTAGCTGAAGAAAAATGG - Intergenic
1010721942 6:79292561-79292583 AGTTAGTAGCTGAATAGCAAAGG + Intergenic
1010930243 6:81792736-81792758 ATTTGGTTGCTGTAAAAAAATGG - Intergenic
1011360062 6:86514184-86514206 ATCTATTACCTGATTAAAAATGG - Intergenic
1011807187 6:91085494-91085516 ATTTTGTAACAGAATAAAATTGG - Intergenic
1012626657 6:101412270-101412292 ATTTAGTATTGAAATAAAAATGG + Intronic
1012914133 6:105150226-105150248 ATTCAGTAGCACAATAAATAGGG - Intergenic
1012943718 6:105443824-105443846 CATTATTAACTGAATAAAAATGG + Intergenic
1012987421 6:105889588-105889610 ACTTACTAGCTGAATAATATTGG - Intergenic
1013218146 6:108049730-108049752 ATTTTGTAAATGAATAAAACAGG - Intronic
1013247194 6:108298052-108298074 ATTTTATAGATGAATAAACAAGG + Intronic
1013432320 6:110066146-110066168 TTTTAGTAGCTGTTTAAAGAAGG - Intergenic
1013644784 6:112125813-112125835 ATATAGTAAGTGAATAAAATGGG + Intronic
1013877277 6:114847701-114847723 ATTTATTAGCTGAATAAACTTGG - Intergenic
1014070221 6:117173126-117173148 CTTTATTAACTGAAGAAAAATGG - Intergenic
1014637583 6:123867109-123867131 ACTTAGTAGCTGATTAGATACGG - Intronic
1014807716 6:125849170-125849192 TTGTAGTAGCTGAATGAAAACGG - Intronic
1014822682 6:126009690-126009712 ATTTATTAGGTGTATATAAATGG + Intronic
1014828769 6:126076810-126076832 AATTACTACCTGAATTAAAATGG + Intergenic
1015971035 6:138742622-138742644 ATTGACTTGGTGAATAAAAAGGG + Intergenic
1016101733 6:140110219-140110241 AGTAAGTATCTGAATGAAAAAGG - Intergenic
1016473121 6:144396607-144396629 ATATAGTAGGTGAATTTAAATGG + Intronic
1019232067 6:170575356-170575378 ATTCAGTATCTGAAATAAAAAGG + Exonic
1020239863 7:6385377-6385399 ATTTTGCAGGTGAAAAAAAAAGG + Intronic
1020491920 7:8796851-8796873 ATTTAAAAACTGAATTAAAATGG + Intergenic
1020494354 7:8829659-8829681 CTTTAGTATCTGAATAATACTGG + Intergenic
1020589460 7:10116314-10116336 ATTTAATAGCTTAATAATCAAGG - Intergenic
1020748876 7:12113539-12113561 ATTAAGTAGCTAAAATAAAAGGG + Intergenic
1021526320 7:21592872-21592894 ATTTTGTAGCAGAAAAAAAAAGG + Intronic
1021715451 7:23457891-23457913 ATGTTGTATCTGAACAAAAAAGG + Intronic
1022691941 7:32664810-32664832 ATTTAGTACAAAAATAAAAAAGG + Intergenic
1023461435 7:40401805-40401827 ATTTAGTATTTGAACAAAGAAGG + Intronic
1023650636 7:42365258-42365280 CTTTATTAGCAGAATGAAAAGGG - Intergenic
1024558651 7:50625245-50625267 ATTTAGTACTTGAATATAATTGG - Intronic
1025193281 7:56912535-56912557 ATTTCAAAGCTGTATAAAAATGG + Intergenic
1025678660 7:63664389-63664411 ATTTCAAAGCTGTATAAAAATGG - Intergenic
1026995921 7:74616539-74616561 ATTTTCTAGCTTAATGAAAATGG - Intergenic
1027561476 7:79736973-79736995 ATTTATTTGCTGTATAAATATGG + Intergenic
1027693982 7:81385711-81385733 ATTTAGTAAATGTATCAAAATGG + Intergenic
1027966050 7:85009938-85009960 ATCAAGTAAATGAATAAAAAAGG + Intronic
1027967475 7:85030514-85030536 ATTTAGTAGTTATTTAAAAATGG + Intronic
1027969020 7:85053028-85053050 AGTTAGTAGCTGAAGATGAAGGG + Intronic
1028456015 7:91038964-91038986 ATTTATTAGCAGCATGAAAATGG + Intronic
1028489579 7:91396031-91396053 ATAAGGTAGCTGAATAAATAGGG - Intergenic
1028661307 7:93279399-93279421 ATAGAGGAGCTGAATAAAGAAGG + Intronic
1029374467 7:100169620-100169642 ATTTATTTGCAGAATAAACATGG + Exonic
1030446879 7:109656813-109656835 ATTAAGTTGCTGAAAATAAAAGG + Intergenic
1030948297 7:115755531-115755553 AATTTATAGCTGAAAAAAAATGG - Intergenic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031396111 7:121276403-121276425 ATTTAGTAAAAGAATAAACAAGG - Intronic
1031806565 7:126315039-126315061 ATTCAGTAAATGAATAAAACAGG - Intergenic
1031941963 7:127798555-127798577 AGTAAGTAGGTTAATAAAAATGG - Intronic
1032641574 7:133774914-133774936 CTTTATTAGTTGAATAAATAAGG + Intronic
1032944144 7:136830642-136830664 CATTATTAGCTGAAGAAAAATGG - Intergenic
1033429186 7:141273403-141273425 ATTTAATTGATGAATAAAGATGG - Intronic
1033554469 7:142476709-142476731 ATTTGGGAGCTGGATAGAAATGG - Intergenic
1034782540 7:153894084-153894106 ATTGAGTTGCTTAATGAAAATGG + Intronic
1035912468 8:3582822-3582844 ATTTAGTAGCTAGACTAAAAAGG - Intronic
1037184415 8:16045183-16045205 ATTTATTCACTGACTAAAAATGG - Intergenic
1037362823 8:18091900-18091922 CTTTATTAACTGAAGAAAAATGG + Intergenic
1037519391 8:19665247-19665269 ATTTTGAAGCTGAGTAAAAATGG - Intronic
1038115863 8:24554479-24554501 ATTTATAAGCTGCATAACAAAGG - Intergenic
1038271947 8:26082376-26082398 ATTTAGTAGCTATTTTAAAATGG - Intergenic
1039695830 8:39910300-39910322 AGTTAGTAGCTGAATGGCAAAGG - Intronic
1041369549 8:57144010-57144032 CTTTCTTTGCTGAATAAAAATGG - Intergenic
1041992174 8:64006386-64006408 ATTTAGTAGAAAAAGAAAAAGGG - Intergenic
1042388781 8:68208573-68208595 TTTTAATAGCTGAATAAAATGGG + Intronic
1042448481 8:68917302-68917324 ATTTAGTAAATGAATAAAAATGG + Intergenic
1043256023 8:78137629-78137651 ATTTGGTAGCTTACAAAAAAAGG - Intergenic
1043994119 8:86791486-86791508 ATTTAATAGCTGAATGTAAGTGG + Intergenic
1046310067 8:112424112-112424134 ATTTTGTATCTGAATGCAAAAGG + Intronic
1046319241 8:112549323-112549345 ATATAATAGGTGAATATAAATGG - Intronic
1047208315 8:122820689-122820711 TTTTATAAGCTGAATAAGAATGG + Intronic
1047408434 8:124604612-124604634 ATACAGTAGCTGAATAAAACAGG - Intronic
1048121997 8:131592052-131592074 AATTATTAACTGAAGAAAAATGG + Intergenic
1048312158 8:133332221-133332243 ATTTATTTGTTGAATAAACAAGG + Intergenic
1048805203 8:138234673-138234695 ATGAAGTAGCTGAATACAAGAGG - Intronic
1050469062 9:5965968-5965990 ATTCAGTAACTGATGAAAAAAGG + Intronic
1051069730 9:13150931-13150953 ATTCATAAGCTGAATACAAAGGG + Intronic
1051472259 9:17457937-17457959 ATTTAGGAGCTGATTTAAACTGG + Intronic
1052237105 9:26224438-26224460 ATTTATTAGCTGAATAACCTTGG + Intergenic
1052703803 9:31969966-31969988 ATGTTGTAGCTAAATAAAAAAGG + Intergenic
1053259334 9:36648196-36648218 ATTTACAAGCAGAATAAAAGGGG + Intronic
1054776101 9:69124893-69124915 ACCTGGTAGCTTAATAAAAATGG + Intronic
1057574615 9:96232271-96232293 CTATAAGAGCTGAATAAAAAAGG + Intergenic
1058041272 9:100304521-100304543 CTTTTGTAGAAGAATAAAAATGG + Intronic
1058414099 9:104767133-104767155 ATTTGGGAGCTTTATAAAAATGG + Intronic
1059197841 9:112387550-112387572 ATTTAGTAGTTGAATAAACATGG + Intronic
1060809130 9:126599930-126599952 ATTTTGTAACACAATAAAAAAGG + Intergenic
1186396020 X:9209952-9209974 GTTTAGGAGCTGATTATAAAAGG - Intergenic
1186830127 X:13381893-13381915 ATTTAGTATATGAAGAAAAAAGG + Intergenic
1187167684 X:16820011-16820033 ATTTACCAGCTCAATGAAAAAGG - Intronic
1187311366 X:18146560-18146582 ATTAAGTAGCTGTATAACACTGG - Intergenic
1188003129 X:25000730-25000752 GATTAGTACCTGAAAAAAAATGG + Intergenic
1188077010 X:25790123-25790145 ATTTAGTACATTAACAAAAAAGG + Intergenic
1188394933 X:29670607-29670629 AGTAAGTAGGTGAATCAAAAAGG + Intronic
1188657244 X:32713525-32713547 ATATAGTAGCTGAAAGGAAAGGG - Intronic
1189665181 X:43347375-43347397 AATTAGTTCCTGAATAAAATGGG - Intergenic
1189669591 X:43394198-43394220 CTTTATCAGCTGCATAAAAATGG - Intergenic
1189763448 X:44345164-44345186 ATATTGTTGATGAATAAAAAAGG - Intergenic
1190729349 X:53215032-53215054 GTTTATTGGATGAATAAAAATGG - Intronic
1192607090 X:72529609-72529631 ATTTAGTAGCTTAAAACAACAGG - Intronic
1192617004 X:72635931-72635953 ATTTAGTAGCTGAATAAAAAAGG + Intronic
1192688935 X:73339342-73339364 GTTTTGTGGCTGAATAAAGATGG + Intergenic
1193410459 X:81156747-81156769 ATTTAATAACTGAATAAATGGGG + Intronic
1196591768 X:117493781-117493803 AAATAGTAGCTGAGAAAAAATGG - Intergenic
1196614627 X:117753817-117753839 ATTTAGAAGCTCAATACAAGTGG - Intergenic
1197019777 X:121672986-121673008 AAATAATGGCTGAATAAAAAAGG - Intergenic
1197323696 X:125065500-125065522 CATTATTAGCTGAAGAAAAATGG - Intergenic
1197388974 X:125837498-125837520 TTTTAGTACTTGAATGAAAATGG - Intergenic
1197437583 X:126451627-126451649 ATTTAATATCTGGATAAATAAGG + Intergenic
1198457680 X:136833127-136833149 TATTACTAGCTGAAGAAAAATGG + Intergenic
1199160892 X:144610276-144610298 ATTTAGTGTTTGAATAAACAGGG - Intergenic
1199386299 X:147226955-147226977 GTTTAGTAGATGAATGAGAATGG - Intergenic
1199401485 X:147404595-147404617 ATATAATAGCAAAATAAAAAAGG + Intergenic
1199819988 X:151435194-151435216 ATTTAGTAGTTAAAAAAAAATGG + Intergenic
1201181613 Y:11353219-11353241 ATATAGAAACTGAAAAAAAAAGG + Intergenic
1201261335 Y:12161691-12161713 CTTTAGCAGCAGAATGAAAACGG - Intergenic