ID: 1192617793

View in Genome Browser
Species Human (GRCh38)
Location X:72646041-72646063
Sequence CTGCATGTATAGAGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1192617787_1192617793 19 Left 1192617787 X:72645999-72646021 CCAGAATGAACTTATCAAGCACA 0: 1
1: 0
2: 1
3: 5
4: 127
Right 1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1192617793 Original CRISPR CTGCATGTATAGAGGGAGGT GGG Intronic
903565977 1:24266178-24266200 ATGGATGGATAGAGGGAGGGTGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905881940 1:41469701-41469723 CTGCATGTCTAGAGGCGTGTGGG - Intergenic
907593093 1:55694372-55694394 CTACCTGTAGAGTGGGAGGTTGG + Intergenic
907611117 1:55872170-55872192 CTCCATGTGTGGAGGGAGGGAGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
910120505 1:83783921-83783943 AGGCATGAATAGTGGGAGGTGGG - Intergenic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
914358431 1:146909048-146909070 CTGCTTGTATCTTGGGAGGTGGG + Intergenic
914494994 1:148187959-148187981 CTGCTTGTATCTTGGGAGGTGGG - Intergenic
914701859 1:150141621-150141643 CTCCATGTATAGAAGGAAGGTGG - Intronic
914841030 1:151248996-151249018 CTGCATGAAGACAGGGGGGTAGG - Intronic
916145881 1:161739034-161739056 CTGAAGGTATAGAAGCAGGTGGG + Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
919816662 1:201445129-201445151 CTGCAGGCAGAAAGGGAGGTAGG + Intergenic
921265962 1:213420831-213420853 CTGCATGTTCAGAGGGAGCGTGG - Intergenic
921284832 1:213599972-213599994 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
923055435 1:230423299-230423321 CTGCATGGGTAGAGTGGGGTAGG - Intronic
924662541 1:246034954-246034976 CTGCATATATTGGGGGAGGAAGG - Intronic
1062984180 10:1752203-1752225 CTCCATGCAAAGAGGAAGGTTGG + Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1065746811 10:28849490-28849512 CTGCAGGGATGGATGGAGGTAGG + Intronic
1070348723 10:75571269-75571291 TTGGATGTATAGAGGGAATTAGG + Intronic
1072519628 10:96219530-96219552 CTGAATGGATATAGGGAAGTTGG + Intronic
1073583476 10:104687706-104687728 CTGCCTGTCAAGAGGGTGGTGGG + Intronic
1073979687 10:109140886-109140908 CAGGATGAAGAGAGGGAGGTGGG + Intergenic
1076162301 10:128254620-128254642 CAGCAGGCAGAGAGGGAGGTTGG + Intergenic
1077370445 11:2179374-2179396 CTGCATGCATGGAGGATGGTGGG + Intergenic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1078332434 11:10436387-10436409 CCACATGTAAAGAGGGAGTTAGG - Intronic
1079114167 11:17630067-17630089 GTGCATGTGTAGAGGGAATTTGG - Intronic
1080390515 11:31841815-31841837 ATGCATCTATAGTGGGAGATAGG + Intronic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1082817888 11:57522450-57522472 CTGGATGTGGAGAGTGAGGTGGG - Intergenic
1083633621 11:64108620-64108642 CTTCCTGTCTAGTGGGAGGTGGG + Intronic
1083882489 11:65555415-65555437 CTGCATATATAGAGAGGGGGGGG - Intronic
1085464244 11:76713397-76713419 ATGCATGGATAGATGGTGGTGGG + Intergenic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1089302466 11:117506970-117506992 CTGCATTTCTAGCGGGAGGAAGG - Intronic
1089389511 11:118091006-118091028 CTGCATTCATTGAGGTAGGTAGG - Intronic
1090479908 11:127059051-127059073 ATGCATGAATTGAGGGAGTTTGG + Intergenic
1092993341 12:13924525-13924547 CAGCAGGGATAGAGGGAGCTGGG + Intronic
1094462861 12:30716535-30716557 CTACATGTATAGATGGCAGTTGG + Exonic
1095477786 12:42603509-42603531 GTGCATGCATAGAGGGTGGAGGG - Intergenic
1095858097 12:46884233-46884255 ATGAATTTAGAGAGGGAGGTAGG - Intergenic
1098171637 12:67752998-67753020 CTGCATTCATGGAGGGTGGTAGG + Intergenic
1104599361 12:130142095-130142117 TTGCACGGATAGAGGGAGGGAGG - Intergenic
1105211651 13:18260687-18260709 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1106633650 13:31504293-31504315 CTCCATGTGTTGAGGGAGGGAGG + Intergenic
1106848085 13:33759425-33759447 CTGCATTGATAGAGGGAAATGGG - Intergenic
1113386040 13:109849146-109849168 CTGCATGTGTAGAAGGATGATGG + Intergenic
1114375705 14:22144288-22144310 CTTCATGTGTAAAGGCAGGTTGG + Intergenic
1114962158 14:27906340-27906362 GTGCATGTATACAGTGAAGTAGG + Intergenic
1115571615 14:34671998-34672020 CTCCATGTGTTGAGGGAGGGAGG - Intergenic
1118182009 14:63503168-63503190 CTGTATGTACAGAGGGATTTTGG + Intronic
1118857134 14:69632367-69632389 CTGCATTTACTGAGGGAGGAGGG - Intronic
1121092952 14:91195509-91195531 CTGAAGGTATGCAGGGAGGTAGG + Intronic
1122275759 14:100589960-100589982 ATGCATGGATGGATGGAGGTGGG + Intergenic
1122517483 14:102319084-102319106 CTGGATGGATAGAGAGAGGGTGG + Intronic
1122900042 14:104778648-104778670 CTGCACGTATAAGGGGAGGTGGG - Intronic
1123947753 15:25247098-25247120 CTCCATGTAGGGAAGGAGGTAGG - Intergenic
1126315374 15:47364022-47364044 CTTCATGTGTCGAGGGAGGGAGG - Intronic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1131697367 15:94892500-94892522 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
1133975125 16:10595047-10595069 ATTCCTGTATGGAGGGAGGTTGG + Intergenic
1135343664 16:21669578-21669600 GAGCATGTAGAGAGGGAGATGGG - Intergenic
1137453361 16:48598041-48598063 TGGCATTTATAGAGGGAGTTGGG - Intronic
1137660822 16:50204526-50204548 CTGCAAGTATAGGAGGAGGCTGG + Intronic
1138384301 16:56625739-56625761 CTCTATTTATAGACGGAGGTCGG - Exonic
1139314106 16:66053490-66053512 ATGTATGTATATAGGTAGGTAGG - Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1141899351 16:86980543-86980565 ATGCATGGATAGATGGATGTGGG + Intergenic
1141946011 16:87310713-87310735 CTGGCTGCATGGAGGGAGGTGGG - Intronic
1142620110 17:1160056-1160078 CTGCCTGGAGACAGGGAGGTAGG + Intronic
1144290773 17:13824135-13824157 CAGCATGTCTGAAGGGAGGTGGG + Intergenic
1145908887 17:28531459-28531481 CTGCCTCTAGAGAGGGAGCTGGG - Intronic
1146127631 17:30241277-30241299 CTGTATGTGTACAGGGCGGTGGG - Intergenic
1146434260 17:32828639-32828661 CTACATGCAGAGAGGGAGGGAGG + Intronic
1147988965 17:44321885-44321907 CTGCATGTGTAGAGGCAGGGAGG - Intronic
1148488805 17:48009850-48009872 CTGCATCTATAGAGGAAACTTGG - Intergenic
1149085530 17:52710649-52710671 CTGCCTATAGAGAGGCAGGTGGG + Intergenic
1149185430 17:53991735-53991757 TGGCATTTATAGAGGAAGGTGGG + Intergenic
1149998969 17:61420341-61420363 TTGTTTGTATGGAGGGAGGTGGG - Intergenic
1150970775 17:70025102-70025124 CTGCCTGCAAAGGGGGAGGTTGG - Intergenic
1151175022 17:72281030-72281052 GTGCATGCATAGGTGGAGGTGGG - Intergenic
1151309360 17:73283943-73283965 CTACATGGAGACAGGGAGGTGGG + Exonic
1153696379 18:7646902-7646924 CTGTATTTTTAGGGGGAGGTGGG + Intronic
1155185821 18:23385751-23385773 CTGCATGTTTAGAGGAACTTGGG + Intronic
1156318129 18:35990445-35990467 CTGCATCTGGACAGGGAGGTTGG + Exonic
1158068263 18:53439460-53439482 CAGCAAGTGTAGAGGGAGCTAGG - Intronic
1158747520 18:60218454-60218476 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
1160318200 18:77867316-77867338 CTGCAGGTGGAGAGGAAGGTGGG - Intergenic
1161663797 19:5562986-5563008 CTGCAGGAAGAGAGGGAGTTGGG + Intergenic
1165709593 19:38000742-38000764 CAGCATGTATATAGAGAAGTGGG - Intronic
1167040125 19:47019120-47019142 CTGCATGGAGAGAAGGAGCTAGG + Intergenic
1168291952 19:55361435-55361457 CTGCAGAGATAGAGGGAGGCAGG + Intronic
1168421077 19:56204155-56204177 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168424367 19:56226765-56226787 CTGGAGGGATAGAGGGAGGGAGG + Intronic
1168426305 19:56241978-56242000 CTGGAGGGATAGAGGGAGGGAGG - Intronic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
928270876 2:29853595-29853617 CTGCATGGAGAGTGGTAGGTAGG - Intronic
934301970 2:91781768-91781790 ATGAATGGATAGAGGGAGGGAGG - Intergenic
934476407 2:94596418-94596440 GTGCATGGCTAGAGGAAGGTGGG + Intronic
934573013 2:95383979-95384001 CTGCATGGAGAGAGGAAGGGAGG - Intronic
935452008 2:103220686-103220708 CTGCATGTTAAGATGAAGGTTGG - Intergenic
935486960 2:103668648-103668670 CTGCATGTATATAGGTAGATAGG + Intergenic
935673562 2:105575667-105575689 CTGCAAGTTCAGAGGGAGGGTGG + Intergenic
936968552 2:118151725-118151747 CTGCATTTTAAGAGGGATGTGGG + Intergenic
937048257 2:118864555-118864577 CTGAATTTATGGAGGGATGTAGG - Intergenic
937981765 2:127619945-127619967 CTGCATTCAGGGAGGGAGGTGGG + Intronic
939036874 2:137142927-137142949 CTGCATGAATAGATTGAGGGAGG - Intronic
940598772 2:155829631-155829653 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
942442260 2:176048882-176048904 CTCCATGCATTGAGGGAGGGAGG + Intergenic
943116619 2:183679667-183679689 CTGCATTTATAGAGTCAGGGAGG - Intergenic
943347577 2:186757713-186757735 ATGCATGTCTAGAAGGAGTTAGG - Intronic
944738433 2:202589363-202589385 CTCCATGTAGAGAGGGAGAGGGG + Intergenic
945103171 2:206282371-206282393 CTGCATGGATGTGGGGAGGTGGG + Intronic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
947229327 2:227869585-227869607 CTGCATGTATGCAGGGAGACTGG - Intergenic
947510564 2:230749554-230749576 CTGCATGTATAGATAAAGATGGG + Intronic
948101871 2:235381613-235381635 CTGTTTGTATAGGGGGTGGTTGG + Intergenic
948757053 2:240165964-240165986 CTCCATGTGTGGAGGGAGGGAGG + Intergenic
1172936252 20:38622680-38622702 CTGCAGGCATGGAGGGATGTGGG - Intronic
1173379050 20:42521047-42521069 ATGTATGTATATAGGTAGGTGGG - Intronic
1174740362 20:53007270-53007292 GTGCATGGACAGAGGAAGGTTGG + Intronic
1174922123 20:54715012-54715034 CTGCTTGAATAAAGGGAGTTGGG - Intergenic
1175553730 20:59833079-59833101 CTGTAAGTAGAGAGGCAGGTTGG + Intronic
1177125198 21:17185250-17185272 CTGGGTTTATAGAGGGAGGAAGG - Intergenic
1178122359 21:29482155-29482177 CTGTATGTATAAAAGGAGCTTGG + Intronic
1178668576 21:34570105-34570127 CTGCATTTATATAGGGATTTAGG - Intronic
1180814459 22:18780955-18780977 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1181200647 22:21215291-21215313 ATGAATGGATAGAGGGAGGGAGG + Intronic
1181269949 22:21652945-21652967 CTGCGTGTATTGGGGGTGGTGGG + Intronic
1183373312 22:37448013-37448035 GTGCATGTAGAGAGGCAGTTTGG - Intergenic
1203226270 22_KI270731v1_random:80144-80166 ATGAATGGATAGAGGGAGGGAGG - Intergenic
1203264558 22_KI270734v1_random:6642-6664 ATGAATGGATAGAGGGAGGGAGG + Intergenic
949289464 3:2447212-2447234 CTCCTTGTATGGAGGGAGGTGGG - Intronic
950474196 3:13205512-13205534 GTGGATGGATAGAGGGAGGGAGG - Intergenic
952344789 3:32473283-32473305 CTACATGTTTATAGGGAAGTTGG - Intronic
952630803 3:35464176-35464198 CCCCATGTATTGAGGGAGGAAGG - Intergenic
953661712 3:44895536-44895558 CTGCAGTTGGAGAGGGAGGTGGG + Intronic
956906968 3:73776530-73776552 CTCCATGTGTCAAGGGAGGTAGG - Intergenic
959472677 3:106772000-106772022 ATGCCTGTATAGAGGGATATAGG - Intergenic
964812919 3:160684899-160684921 GTACATGTGTAGCGGGAGGTGGG - Intergenic
965348689 3:167585980-167586002 CTGGATGGATAGATGGAAGTCGG + Intronic
965507767 3:169535108-169535130 CGGCTTAGATAGAGGGAGGTAGG - Intronic
965946987 3:174255085-174255107 CTGGGTGTTTAGAGGAAGGTAGG + Intronic
966071494 3:175884722-175884744 ATGGATGAATTGAGGGAGGTAGG - Intergenic
966088958 3:176107309-176107331 CTGCGTGTACACAGGGAGATGGG + Intergenic
966622465 3:181980645-181980667 CTGCATGCACAGAGGGGGGGGGG + Intergenic
967860618 3:194148671-194148693 GTGCATGGGTAGAAGGAGGTGGG - Intergenic
969683529 4:8656424-8656446 CTTCATGTAGAGAGAGAGGCAGG - Intergenic
970463090 4:16295573-16295595 CTCAAAATATAGAGGGAGGTGGG + Intergenic
971468926 4:26998360-26998382 CTTCATGGATTGAGGTAGGTAGG - Intronic
972232588 4:37093010-37093032 CTCCATGTGTAGAGGGAGAGGGG + Intergenic
972617431 4:40713271-40713293 CTGCATGTTTAAAGTGAGCTAGG - Intergenic
972910335 4:43808434-43808456 ATGAATGTAGAGAGGGAGGGAGG + Intergenic
978081556 4:104599200-104599222 CCCCATGTGTCGAGGGAGGTAGG + Intergenic
978630657 4:110739980-110740002 CTACAAGTAGAGAGGGAGGCAGG - Intergenic
979305604 4:119139547-119139569 CTGAATGAAGAGAGAGAGGTAGG + Intronic
979372106 4:119901327-119901349 ATGCATGTTTAGATGCAGGTAGG - Intergenic
983578917 4:169288268-169288290 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
986242967 5:5978000-5978022 CTGCATGTCACCAGGGAGGTAGG + Intergenic
988018847 5:25597333-25597355 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
988636882 5:32994539-32994561 GTGTGTGTAGAGAGGGAGGTAGG - Intergenic
992321073 5:75613480-75613502 CTGCATATATAAATGAAGGTAGG + Intronic
993312786 5:86357669-86357691 CTGCATGAAAAGAGGGAGAGTGG - Intergenic
993364398 5:87018969-87018991 CTCCATGTAGAGAGGGAGAAGGG + Intergenic
993716745 5:91282452-91282474 CCCCATGTATCGAGGGAGGGAGG + Intergenic
996209041 5:120782309-120782331 CTGCATGTATGGAGGGATTGTGG - Intergenic
997153597 5:131526930-131526952 TTGTATATATAGAGGGGGGTGGG + Intronic
997835783 5:137192301-137192323 CTGCATGGAGAGACGGAGGGAGG + Intronic
1003036732 6:2646507-2646529 GTGCATGTGTAGTGGGAGGGTGG + Intergenic
1004678492 6:17868465-17868487 CTGCATGTATATATGAAGTTCGG + Intronic
1007385584 6:41518216-41518238 CTGCATGTAAACATGGAGGAAGG + Intergenic
1008233469 6:49013946-49013968 ATGAATGTCTAGAGGGAGTTTGG + Intergenic
1008888768 6:56460628-56460650 CTGCATGCATAGAGGGGGCATGG + Intronic
1011089690 6:83583197-83583219 CGGCATGTATATGGGGATGTGGG - Intronic
1012324766 6:97903471-97903493 ATACATGTATAGAGAGAGATAGG + Intergenic
1012599602 6:101078942-101078964 ATGCAACTATATAGGGAGGTAGG + Intergenic
1013317675 6:108957632-108957654 GTGCAGGGCTAGAGGGAGGTAGG - Intronic
1015075513 6:129151795-129151817 CTCCACGTATGGAGGGAGGGAGG - Intronic
1015312950 6:131784720-131784742 CTCCAAGTGTAGATGGAGGTTGG - Intergenic
1016804339 6:148197752-148197774 CCCCATGTATCGAGGGAGGTAGG + Intergenic
1016834301 6:148461982-148462004 GTGCATGTACAGGGGGAGGCAGG - Intronic
1017024951 6:150173435-150173457 CAGCATGTATACAGCAAGGTGGG - Intronic
1017186126 6:151602528-151602550 CCCCATGTATTGAGGGAGGGAGG + Intronic
1017533820 6:155325995-155326017 CTGCTTGTATACAGGGAGAAAGG + Intergenic
1019918933 7:4150636-4150658 CTGAATGTAGGGAGGGAGGCAGG + Intronic
1022133613 7:27426355-27426377 CTGCATGGATAGAGTGAGTCAGG + Intergenic
1023564359 7:41508695-41508717 CAGCTTCTATAGTGGGAGGTGGG + Intergenic
1025638460 7:63346082-63346104 CTACATGCATAGAGGGATGAGGG + Intergenic
1025644236 7:63402007-63402029 CTACATGCATAGAGGGATGAGGG - Intergenic
1025713832 7:63935070-63935092 CTACATGCATAGAGGGATGAGGG - Intergenic
1027804550 7:82800539-82800561 TTAAATGTATAGAGAGAGGTTGG + Intronic
1028099711 7:86804809-86804831 CTGCATTTAAAGAGGATGGTAGG + Intronic
1028667574 7:93364298-93364320 CTGCATGTCTAGGGGCAGGGTGG - Intergenic
1029311068 7:99665358-99665380 CTGCATGTATAGTGGAAGGACGG - Intronic
1029316104 7:99715951-99715973 CTGCACGCATAGAGGAAGGATGG - Intronic
1029321765 7:99768547-99768569 TTGCATGCATAGAGGAAGGATGG - Intronic
1031723956 7:125212791-125212813 CTGCATCAATAGAAGGAGCTTGG + Intergenic
1032306816 7:130741796-130741818 CTGCCTTTACAGAGGGAGGAAGG - Intergenic
1032511619 7:132477236-132477258 GTGTATGTATGCAGGGAGGTGGG - Intronic
1035148640 7:156846612-156846634 CTGAATGTATAGATGAAGTTGGG - Intronic
1035531120 8:351558-351580 ATGCAGGTAGAGAGGCAGGTAGG + Intergenic
1035643060 8:1198449-1198471 CTGCACTTATAGAGGTGGGTGGG - Intergenic
1036623630 8:10446020-10446042 CTGGAAGGATGGAGGGAGGTGGG + Intergenic
1040752715 8:50729709-50729731 CTGTATGTAAAGAGGAAGGGAGG + Intronic
1042253418 8:66778761-66778783 CTGGATTTATAGAGGGGAGTGGG + Intronic
1042425323 8:68641266-68641288 CTGCTTGGATATAGGGAGGGAGG + Intronic
1047806523 8:128366740-128366762 TAGCATATATAGTGGGAGGTAGG + Intergenic
1048920022 8:139219672-139219694 CTGAATGAAGAGAGGGAGGGAGG - Intergenic
1048932849 8:139329291-139329313 CTTCATGTATGGTGTGAGGTAGG + Intergenic
1049253302 8:141600828-141600850 CTGCATGTGTAGAGGGTGCCTGG - Intergenic
1053153502 9:35757358-35757380 CTGACTGTATGGAGGCAGGTGGG + Exonic
1053161978 9:35819469-35819491 CTGCGTGCATAGGGGGTGGTGGG - Intronic
1055709574 9:79045394-79045416 CTGCCTGTAGAGATGGGGGTTGG - Intergenic
1057491850 9:95526221-95526243 CTGCATATTTAGGGGGAGGCGGG + Intergenic
1057860104 9:98634201-98634223 CTGCGTGTATAGACTGAAGTAGG - Intronic
1059792013 9:117650286-117650308 TGGCATGTATAGGTGGAGGTGGG + Intergenic
1060018102 9:120104662-120104684 ATGCGTGTGGAGAGGGAGGTTGG + Intergenic
1060406656 9:123376219-123376241 CTGGAGGTACAGAGGGAGGCTGG + Intronic
1060944967 9:127564907-127564929 GAGCATGTACAGAGAGAGGTAGG + Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1187790095 X:22941384-22941406 CTGCAAATATAGAGAGAGCTGGG + Intergenic
1191984678 X:66967282-66967304 CTGGCTGTATAGAGTGAGCTTGG + Intergenic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1195844991 X:109217142-109217164 CTGCAGGTATAGGGAGAGGTTGG + Intergenic
1198594303 X:138219487-138219509 AGGAATGTATAGAGGGAGATTGG + Intergenic